bicluster | n.genes | n.arrays | score | residual | profile | network | motif1 | motif2 | motif.posns | probe.names | short.names | long.names |
1 | 13 | 373 | -53.830 | 0.406 | Residual = 0.406 | | CCgGATGC | TGATGGTTCGatTCaTGTgTT | | DVU0383 DVU0824 DVU0964 DVU1243 DVU1790 DVU1962 DVU2120 DVU2139 DVU2169 DVU2326 DVU2602 DVU2622 DVU2915 | | hypothetical protein | Glu/Leu/Phe/Val dehydrogenase family protein | MutS2 family protein | methyl-accepting chemotaxis protein | histone deacetylase family protein |
2 | 11 | 368 | -54.997 | 0.423 | Residual = 0.423 | | ACAAAaAT | TTCATgCAgCACCcT | | DVU0078 DVU0382 DVU0443 DVU0920 DVU1112 DVU1487 DVU1489 DVU2168 DVU2539 DVU2741 DVU2881 | atpI livG | hypothetical protein | exonulcease, putative | ATP synthase protein I | major head protein | high-affinity branched chain amino acid ABC transporter, ATP-binding protein | phage/plasmid primase, P4 family |
3 | 15 | 369 | -59.353 | 0.402 | Residual = 0.402 | | AATnGaTCcCnGAAAGAAAGA | tCgaGcgtGAaCCCgACGCC | | DVU0230 DVU0426 DVU1482 DVU1699 DVU1957 DVU2158 DVU2249 DVU2296 DVU2343 DVU2432 DVU2567 DVU3078 DVU3249 DVU3251 DVUA0046 | mtgA | transcriptional regulator cII, putative | chromate transport family protein | hypothetical protein | monofunctional biosynthetic peptidoglycan transglycosylase | amino acid ABC transporter, ATP-binding protein | sensory box/GGDEF domain/EAL domain protein | lipoprotein, putative | membrane protein, HPP family | glycosyl transferase, group 2 family protein |
4 | 20 | 371 | -42.339 | 0.451 | Residual = 0.451 | | AActGcAgaAA | tGCAaggGgGCAa | | DVU0483 DVU0595 DVU0662 DVU0663 DVU0664 DVU0725 DVU0812 DVU1013 DVU1212 DVU1629 DVU1839 DVU1874 DVU2324 DVU2439 DVU2467 DVU2468 DVU2469 DVU2974 DVU3283 DVU3316 | cysE cysK grpE fsxA yfiA trx clpB rnr lpxK pyrD | DNA mismatch repair protein MutL, putative | hypothetical protein | serine O-acetyltransferase | cysteine synthase A | cysteine desulfurase | heat shock protein GrpE | type I secretion outer membrane protein, TolC family | fxsA protein | ribosomal subunit interface protein | thioredoxin | ATP-dependent Clp protease, ATP-binding subunit ClpB | copper-translocating P-type ATPase | efflux transporter, RND family, MFP subunit | ribonuclease R | tetraacyldisaccharide 4'-kinase | dihydroorotate dehydrogenase |
5 | 35 | 373 | -26.776 | 0.567 | Residual = 0.567 | | CTTgtTTGgAAGagAATAAattga | CtCACaCCACAaAC | | DVU0036 DVU0052 DVU0057 DVU0060 DVU0061 DVU0062 DVU0063 DVU0064 DVU0085 DVU0602 DVU0603 DVU0872 DVU1009 DVU1454 DVU1571 DVU1617 DVU1618 DVU1619 DVU1851 DVU2130 DVU2148 DVU2208 DVU2274 DVU2284 DVU2299 DVU2634 DVU2671 DVU2904 DVU3151 DVU3194 DVU3204 DVU3205 DVU3206 DVU3212 DVU3313 | era trpB-1 ispD rho gpmA engA purA | hypothetical protein | GTP-binding protein Era | transcriptional regulator, TetR family | efflux transporter, RND family, MFP subunit | multidrug resistance protein, putative | RND efflux system, outer membrane protein, NodT family | transcriptional regulator, MarR family | tryptophan synthase subunit beta | glycosyl transferase, group 2 family protein | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | transcription termination factor Rho | nitroreductase family protein | iojap-related protein | phosphoglyceromutase | peptidase, M23/M37 family | CBS/transporter associated domain protein | glycine/betaine/L-proline ABC transporter, ATP binding protein | HDIG/HD/KH domain protein | radical SAM enzyme, Cfr family | MiaB-like tRNA modifying enzyme YliG, TIGR01125 | GTP-binding protein EngA | adenylosuccinate synthetase | transglycosylase SLT domain protein | phosphoribosylaminoimidazolecarboxamide formyltransferase, putative | pyridine nucleotide-disulfide oxidoreductase | transcriptional regulator, LysR family |
6 | 12 | 364 | -19.130 | 0.558 | Residual = 0.558 | | tGTGAtGC | TGTtATCatCCAATAAT | | DVU0042 DVU0246 DVU0357 DVU0975 DVU0980 DVU1058 DVU1600 DVU1614 DVU1658 DVU2496 DVU2788 DVU3104 | cbiM | RNA methyltransferase, TrmH family, group 3 | pyruvate phosphate dikinase, PEP/pyruvate binding domain protein | hypothetical protein | DAK2 domain protein | cobalt transport protein CbiM | adenylate cyclase | iron-sulfur cluster-binding protein | putative translaldolase | lipoprotein, putative | transcriptional regulator, ArsR family | peptidoglycan-associated lipoprotein, putative |
7 | 16 | 365 | -58.664 | 0.512 | Residual = 0.512 | | cCCaGtTcaTttCTTtCTTgAACc | ACTGAACCTCCCAATATCCCTG | | DVU0070 DVU0086 DVU0190 DVU0191 DVU0192 DVU0193 DVU2450 DVU2458 DVU2808 DVU2876 DVU2879 DVU2880 DVU3105 DVU3211 DVU3280 DVUA0141 | | Ser/Thr protein phosphatase family protein | hypothetical protein | adenine specific DNA methyltransferase, putative | TonB domain protein | terminase, large subunit, putative |
8 | 20 | 371 | -54.714 | 0.449 | Residual = 0.449 | | AAAattTcacatTcttctTaCAAT | AtATCAaaaTaAAanTtCAAACA | | DVU0252 DVU0268 DVU0472 DVU0473 DVU0553 DVU0630 DVU0916 DVU0939 DVU1015 DVU1155 DVU1285 DVU1637 DVU1638 DVU1639 DVU1646 DVU2145 DVU2146 DVU2725 DVU2726 DVU3080 | arsC | hypothetical protein | redox-sensing transcriptional repressor Rex | response regulator | arsenate reductase | chloramphenicol acetyltransferase, putative | transcriptional regulator, putative |
9 | 25 | 368 | -33.509 | 0.469 | Residual = 0.469 | | agcgGGCATgG | TcCTGAaAacC | | DVU0084 DVU0087 DVU0088 DVU0091 DVU0141 DVU0142 DVU0323 DVU0324 DVU0651 DVU0794 DVU1029 DVU1185 DVU1189 DVU1369 DVU1370 DVU1459 DVU1540 DVU1860 DVU1863 DVU2257 DVU2320 DVU2461 DVU2558 DVU2634 DVU3297 | panF trpS folD fabI hisC purU lnt bioB | translation initiation factor, aIF-2BI family, putative | hypothetical protein | sodium/panthothenate symporter | peptidase, M50 family | tryptophanyl-tRNA synthetase | methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase | enoyl-(acyl-carrier-protein) reductase | histidinol-phosphate aminotransferase | colicin V production family protein | formyltetrahydrofolate deformylase | apolipoprotein N-acyltransferase | flagellar synthesis regulator FleN, putative | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase family protein | oligopeptide ABC transporter, permease protein | biotin synthase | tryptophan-specific transport protein |
10 | 25 | 375 | -36.010 | 0.477 | Residual = 0.477 | | TgTCAAGa | TAtgAaCGnAngTT | | DVU0161 DVU0162 DVU0399 DVU0503 DVU0507 DVU0508 DVU0510 DVU0511 DVU0957 DVU1077 DVU1078 DVU1202 DVU1207 DVU1298 DVU1299 DVU1300 DVU1575 DVU1622 DVU2231 DVU2913 DVU2914 DVU2923 DVU3308 DVU3310 DVU3368 | purF carB pnp infB nusA rpsR fabH rpsL rpsG fusA-1 prsA purQ typA prfA nusG hisS | amidophosphoribosyltransferase | carbamoyl-phosphate synthase, large subunit | hypothetical protein | polynucleotide phosphorylase/polyadenylase | translation initiation factor IF-2 | transcription elongation factor NusA | 30S ribosomal protein S18 | inner membrane protein, 60 kDa | R3H domain protein | cytidine/deoxycytidylate deaminase family protein | 3-oxoacyl-(acyl-carrier-protein) synthase III | 30S ribosomal protein S12 | 30S ribosomal protein S7 | elongation factor G | ribose-phosphate pyrophosphokinase | phosphoribosylformylglycinamidine synthase I | GTP-binding protein TypA | lipoprotein, putative | peptide chain release factor 1 | transcription antitermination protein NusG | metallo-beta-lactamase family protein | ATP-dependent RNA helicase, DEAD/DEAH family | histidyl-tRNA synthetase |
11 | 27 | 371 | -37.377 | 0.487 | Residual = 0.487 | | TTTTCttGctATAaT | ATgAaaATAcT | | DVU0170 DVU0729 DVU0820 DVU0821 DVU0822 DVU0912 DVU0937 DVU1121 DVU1263 DVU1773 DVU1774 DVU1811 DVU1812 DVU2107 DVU2117 DVU2264 DVU2304 DVU2345 DVU2585 DVU2615 DVU2616 DVU2676 DVU2833 DVU3045 DVU3107 DVU3155 DVUA0025 | pppA dcrH | methyl-accepting chemotaxis protein | hypothetical protein | type IV prepilin-like proteins leader peptidase | protoheme IX farnesyltransferase, putative | cytochrome c oxidase, subunit II, putative | bacterial extracellular solute-binding protein, family 3 | sensory box histidine kinase/response regulator | cytochrome c family protein | methyl-accepting chemotaxis protein DcrH | response regulator receiver domain protein |
12 | 22 | 367 | -26.123 | 0.592 | Residual = 0.592 | | aAgGtTTtTCA | AttAgaAcAaaCatAaacTaTACC | | DVU0709 DVU0783 DVU0915 DVU1048 DVU1062 DVU1100 DVU1530 DVU1536 DVU1577 DVU1585 DVU1589 DVU1605 DVU1680 DVU1687 DVU1775 DVU1803 DVU1881 DVU1900 DVU1901 DVU2131 DVU2359 DVU2435 | ccmB hslV uvrB suhB ribB | hypothetical protein | cytochrome c-type biogenesis protein CcmB | tail fiber protein, putative | metallo-beta-lactamase family protein | transglycosylase, SLT family | ATP-dependent protease peptidase subunit | vitamin B12-dependent methionine synthase family protein | excinuclease ABC subunit B | inositol-1-monophosphatase | glycosyl transferase, group 2 family protein | 3,4-dihydroxy-2-butanone 4-phosphate synthase | glycosyl transferase, group 1 family protein | phoH family protein | peptidyl-prolyl cis-trans isomerase domain protein | sigma-54 dependent transcriptional regulator | transporter, CorA family |
13 | 20 | 372 | -51.776 | 0.504 | Residual = 0.504 | | acaAggGtgTGAaagntTtCnACA | TTAtGTCACCatTTAtTGGTAAAA | | DVU0447 DVU0527 DVU0759 DVU1083 DVU1466 DVU1488 DVU1729 DVU1821 DVU1822 DVU1823 DVU2116 DVU2986 DVU2987 DVU2988 DVU2989 DVU2990 DVU3336 DVU3337 DVU3338 DVU3339 | maF phoB argB pspC pspA pspF moeA kdpC kdpB kdpA | hypothetical protein | septum formation protein Maf | peptidase, M29 family | phosphate regulon transcriptional regulator PhoB | acetylglutamate kinase | minor tail protein, putative | killer protein, putative | glutamate synthase, amidotransferase subunit, putative | glutamate synthase, iron-sulfur cluster-binding subunit, putative | pilin, putative | phage shock protein C | phage shock protein A | psp operon transcriptional activator | molybdopterin biosynthesis MoeA protein | potassium channel histidine kinase domain protein/universal stress protein | K+-transporting ATPase, C subunit | K+-transporting ATPase, B subunit | potassium-transporting ATPase subunit A |
14 | 30 | 368 | -31.744 | 0.496 | Residual = 0.496 | | aCACcGGCcGCACaaCgGgaGACt | CATcCAaGAnGatA | | DVU0072 DVU0076 DVU0080 DVU0328 DVU0425 DVU0428 DVU0439 DVU0441 DVU0478 DVU0638 DVU0680 DVU0691 DVU0699 DVU0743 DVU1004 DVU1051 DVU1064 DVU1423 DVU1425 DVU1452 DVU1607 DVU1926 DVU2568 DVU2583 DVU2627 DVU2673 DVU2779 DVU3113 DVU3127 DVU3296 | fumC ade ccmE lpdA gcvPA dtd carA pqiB | glucose-1-phosphate cytidylyl-transferase | glycosyl transferase, group 2 family protein | fumarate hydratase | glycosyl transferase, group 1 family protein | hypothetical protein | YCII-related domain protein | adenine deaminase | Ser/Thr protein phosphatase family | sensory box histidine kinase | cytochrome c-type biogenesis protein CcmE | aconitate hydratase | 2-oxoglutarate dehydrogenase, E3 component, lipoamide dehydrogenase | glycine dehydrogenase subunit 1 | D-tyrosyl-tRNA deacylase | peptidase, M20/M25/M40 family | lipoprotein, putative | anaerobic glycerol-3-phosphate dehydrogenase, subunit A, truncation | carbamoyl phosphate synthase small subunit | paraquat-inducible protein B |
15 | 19 | 361 | -31.828 | 0.498 | Residual = 0.498 | | cAtacccaAAcAtAacggcaA | ACGgnCCGtTCCTGC | | DVU0022 DVU0117 DVU0286 DVU0539 DVU0621 DVU0681 DVU0807 DVU1163 DVU2023 DVU2041 DVU2502 DVU2661 DVU2736 DVU2906 DVU2994 DVU3000 DVU3007 DVU3128 DVUA0125 | hisF trmU murB umuC | HAMP domain/GGDEF domain/EAL domain protein | glycosyl transferase, group 2 family protein | imidazoleglycerol phosphate synthase, cyclase subunit | sigma-54 dependent DNA-binding response regulator | sensor histidine kinase/response regulator | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase | major facilitator superfamily protein | hypothetical protein | UDP-N-acetylenolpyruvoylglucosamine reductase | twin-arginine translocation pathway signal sequence domain protein | umuC protein | lipoprotein, putative | transglycosylase, SLT family |
16 | 23 | 368 | -36.815 | 0.476 | Residual = 0.476 | | GaAaAGAcAT | tTATCAtGcgacaCaTCAAG | | DVU0407 DVU0916 DVU0941 DVU1005 DVU1244 DVU1335 DVU1572 DVU1582 DVU1612 DVU1647 DVU1648 DVU1649 DVU1655 DVU1656 DVU1850 DVU1851 DVU1861 DVU1867 DVU2201 DVU2609 DVU2650 DVU2655 DVUA0071 | clpP lysA-1 mutS folK prfB dapF | rare lipoprotein A family protein | redox-sensing transcriptional repressor Rex | peptidase, M16 family | hypothetical protein | ATP-dependent Clp protease, proteolytic subunit | transcriptional regulator, CarD family | ACT domain protein | diaminopimelate decarboxylase | lipoprotein, putative | DNA mismatch repair protein | aspartate aminotransferase | 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase | CBS domain protein | peptidase, M23/M37 family | peptide chain release factor 2, programmed frameshift | diaminopimelate epimerase | alcohol dehydrogenase, iron-containing | chemotaxis MotB protein, putative | D-alanyl-D-alanine carboxypeptidase family protein | glycosyl transferase, group 1/2 family protein |
17 | 31 | 364 | -23.949 | 0.606 | Residual = 0.606 | | TATCAGtAATagTTACTGtTAtcT | AaCTCgTTgCGctttcTCA | | DVU0024 DVU0151 DVU0155 DVU0158 DVU0460 DVU0461 DVU0594 DVU0685 DVU0711 DVU0771 DVU0772 DVU0903 DVU0971 DVU1677 DVU2230 DVU2239 DVU2241 DVU2246 DVU2247 DVU2248 DVU2318 DVU2462 DVU2672 DVU3093 DVU3094 DVU3095 DVU3096 DVU3240 DVU3270 DVU3271 DVU3330 | iciA tpiA deoD pdxA rdl rr cydB cydA | hypothetical protein | HAMP domain/sigma-54 interaction domain protein | type I phosphodiesterase/nucleotide pyrophosphatase family protein | conserved hypothetical protein TIGR00104 | fructose-bisphosphate aldolase | 3-dehydroquinate synthase | chromosome replication initiation inhibitor protein | phosphomannomutase | molybdenum-pterin binding domain protein/site-specific recombinase, phage integrase family | HD domain protein | molybdenum cofactor biosynthesis protein | triosephosphate isomerase | purine nucleoside phosphorylase | glycosyl hydrolase, family 3 | pyridoxal phosphate biosynthetic protein PdxA | S1 RNA binding domain protein | antioxidant, AhpC/Tsa family | rubrerythrin, putative | oligopeptide ABC transporter, permease protein | rubredoxin-like protein | rubrerythrin | transcriptional regulator, Fur family | peptidase, M23/M37 family | cytochrome d ubiquinol oxidase, subunit II | cytochrome d ubiquinol oxidase, subunit I |
18 | 20 | 367 | -45.365 | 0.440 | Residual = 0.440 | | TTgaagaaCAaAAaaAGAaAG | TAAAGTaTACA | | DVU0004 DVU0563 DVU0835 DVU0837 DVU0838 DVU0839 DVU0927 DVU0928 DVU1033 DVU1074 DVU1257 DVU1302 DVU1334 DVU1676 DVU1792 DVU1931 DVU2215 DVU2222 DVU2538 DVU2920 | gyrA rplS rimM rpsP rplU rpmA rpmH rpsJ tig secG rpsU ssb thrS tuf | DNA gyrase, A subunit | ISD1, transposase OrfB | 50S ribosomal protein L19 | 16S rRNA processing protein RimM | hypothetical protein | 30S ribosomal protein S16 | 50S ribosomal protein L21 | 50S ribosomal protein L27 | competence/damage-inducible protein CinA protein, truncation | ribosomal protein L34 | RNA-binding protein | 30S ribosomal protein S10 | trigger factor | preprotein translocase subunit SecG | 30S ribosomal protein S21 | iron-sulfur cluster-binding protein | single-strand binding protein | threonyl-tRNA synthetase | elongation factor Tu |
19 | 14 | 372 | -45.206 | 0.441 | Residual = 0.441 | | atgCCtcATcggCAaGacgC | AAAgTACACAT | | DVU0367 DVU0444 DVU0447 DVU0486 DVU0609 DVU0892 DVU0964 DVU1884 DVU1962 DVU1982 DVU2828 DVU3152 DVU3169 DVU3354 | aroL rhlE cbiG | Ser/Thr protein phosphatase family protein | CBS domain protein | hypothetical protein | lipoprotein, putative | shikimate kinase II | Glu/Leu/Phe/Val dehydrogenase family protein | methyl-accepting chemotaxis protein | ATP-dependent RNA helicase RhlE | site-specific recombinase, phage integrase family | sensory box histidine kinase | cobalamin biosynthesis protein CbiG |
20 | 17 | 370 | -62.638 | 0.461 | Residual = 0.461 | | aaatatcTgTAtttAaTTTgA | ATCgTgTACTgAACgccTTC | | DVU1542 DVU1543 DVU1565 DVU2624 DVU2646 DVU2647 DVU2702 DVU2703 DVU2719 DVU2720 DVU2721 DVU2722 DVU2723 DVU2724 DVU2727 DVU2728 DVU2729 | hrpB | hypothetical protein | ATP-dependent helicase HrpB | D-cysteine desulfhydrase | endoribonuclease, L-PSP family | phage tail tape measure protein, TP901 family, putative | tail protein, putative | phage baseplate assembly protein V, putative |
21 | 10 | 372 | -91.057 | 0.321 | Residual = 0.321 | | TGtgcAttTCTgtTGAaAt | AaAaCgTaAaA | | DVU0887 DVU1122 DVU1490 DVU1696 DVU1712 DVU1757 DVU2165 DVU2186 DVU2262 DVU2344 | | transglycosylase, putative | portal protein, putative | tail tape measure protein, putative | hypothetical protein | site-specific recombinase, phage integrase family | lysozyme, putative |
22 | 26 | 375 | -44.716 | 0.478 | Residual = 0.478 | | GCaTgcttcTTGCaT | aAggGgGgGGaTGaCGnCTCTCg | | DVU0043 DVU0307 DVU0309 DVU0318 DVU0320 DVU0325 DVU0409 DVU0410 DVU0518 DVU0520 DVU0862 DVU0863 DVU1441 DVU1443 DVU1444 DVU1805 DVU1963 DVU2065 DVU2991 DVU3001 DVU3002 DVU3004 DVU3005 DVU3006 DVU3014 DVU3232 | fliQ hypD flgE flgD flhA | flagellar biosynthetic protein FliQ | flagella basal body rod domain protein | transcriptional regulator, LysR family | TPR domain protein | hypothetical protein | hydrogenase expression/formation protein HypD | flagellar hook-associated protein FlgL, putative | flagellar protein FliS/hypothetical protein, fusion | flagellar hook-associated protein 2, putative | flagellin | flagellar hook protein FlgE | basal-body rod modification protein FlgD | GGDEF domain protein | radical SAM domain protein | aminotransferase, DegT/DnrJ/EryC1/StrS family | polysaccharide biosynthesis protein/methyltransferase, putative | asparagine synthetase, glutamine-hydrolyzing | flagellar biosynthesis protein A |
23 | 27 | 363 | -40.403 | 0.471 | Residual = 0.471 | | ATGTGCTGCGGGG | CaCatGaCACaGCCG | | DVU0084 DVU0348 DVU0487 DVU0646 DVU0647 DVU0648 DVU0649 DVU0650 DVU0843 DVU0988 DVU0990 DVU0991 DVU1039 DVU1040 DVU1927 DVU1929 DVU1930 DVU2322 DVU2463 DVU2464 DVU3023 DVU3154 DVU3161 DVU3168 DVU3198 DVU3199 DVU3200 | purE cobI hisB ileS recN hemL recR | translation initiation factor, aIF-2BI family, putative | hypothetical protein | phosphoribosylaminoimidazole carboxylase, catalytic subunit | precorrin-2 C20-methyltransferase | iron compound ABC transporter, periplasmic iron compount-binding protein, putative | iron compound ABC transporter, ATP-binding protein | iron compound ABC transporter, permease protein | chelatase, putative | carbohydrate kinase, PfkB family | endonuclease III, putative | lipoprotein, putative | imidazoleglycerol-phosphate dehydratase | isoleucyl-tRNA synthetase | TPR domain protein | UTP--glucose-1-phosphate uridylyltransferase, putative | DNA repair protein RecN | sigma-54 dependent DNA-binding response regulator | HAM1 family protein | ABC transporter, ATP-binding protein | glutamate-1-semialdehyde-2,1-aminomutase | DNA polymerase III, gamma and tau subunits, putative | conserved hypothetical protein TIGR00103 | recombination protein RecR |
24 | 14 | 369 | -70.046 | 0.379 | Residual = 0.379 | | TTtcGcTAacC | GTCTTTTTgC | | DVU1106 DVU1114 DVU1116 DVU1118 DVU1120 DVU1125 DVU1130 DVU1132 DVU1133 DVU1135 DVU1137 DVU1138 DVU1140 DVU1143 | | hypothetical protein | virion morphogenesis protein | DNA-binding protein | bacteriophage transposase A protein, putative |
25 | 23 | 364 | -20.790 | 0.549 | Residual = 0.549 | | CAncCGcCAtc | AGTTTTT | | DVU0144 DVU0377 DVU0496 DVU0735 DVU0816 DVU1224 DVU1253 DVU1527 DVU1763 DVU1804 DVU1899 DVU1983 DVU2111 DVU2197 DVU2272 DVU2350 DVU2760 DVU3114 DVU3170 DVU3317 DVU3377 DVU3394 DVUA0106 | trxB-1 polA cobQ nfo gid kdsB cobJ dgkA | cytidyltransferase-related domain protein | thioredoxin reductase | DNA polymerase I | MOSC domain protein | cobyric acid synthase CobQ | endonuclease IV | hypothetical protein | site-specific recombinase, phage integrase family | glycosyl transferase, group 1 family protein | DNA repair protein RecO, putative | transcriptional regulator, LysR family | formate acetyltransferase, putative | tRNA (uracil-5-)-methyltransferase Gid | 3-deoxy-manno-octulosonate cytidylyltransferase | precorrin-3b C17-methyltransferase | diacylglycerol kinase | type III secretion target, YopN family |
26 | 23 | 364 | -18.077 | 0.595 | Residual = 0.595 | | TggCAAcGT | CCCngCGTCaTGCCg | | DVU0051 DVU0125 DVU0179 DVU0244 DVU0424 DVU0611 DVU0749 DVU0766 DVU0834 DVU0884 DVU0960 DVU1088 DVU1182 DVU1531 DVU1657 DVU1802 DVU1909 DVU2307 DVU2337 DVU2782 DVU2936 DVU3158 DVU3254 | cls rnhB acpS | conserved hypothetical protein TIGR00044 | hypothetical protein | molybdenum-pterin binding domain protein/site-specific recombinase, phage integrase family | cardiolipin synthetase | ABC transporter, ATP-binding protein | DNA-binding response regulator | transporter, putative | ribonuclease HII | methyltransferase, putative | holo-(acyl-carrier-protein) synthase | C4-type zinc finger protein, DksA/TraR family | peptidase, M23/M37 family | vacJ lipoprotein, putative | PDZ domain protein |
27 | 29 | 361 | -25.633 | 0.539 | Residual = 0.539 | | cAAACAGgAtGAa | CTgcagCaggAGCCGGAgGTC | | DVU0180 DVU0659 DVU0765 DVU0799 DVU0870 DVU1005 DVU1174 DVU1402 DVU1410 DVU1600 DVU1824 DVU1825 DVU1826 DVU1891 DVU2013 DVU2112 DVU2381 DVU2496 DVU2670 DVU2755 DVU2764 DVU2769 DVU2771 DVU2804 DVU2903 DVU2938 DVU3148 DVU3201 DVU3352 | modC frr malQ | molybdenum ABC transporter, ATP-binding protein | hypothetical protein | hydroxypyruvate reductase, putative | ribosome recycling factor | transcriptional regulator, LysR family | adenylate cyclase | amidohydrolase family protein | hydroxylamine reductase | lipoprotein, putative | nitroreductase family protein | metallo-beta-lactamase family protein | HD domain protein | 4-alpha-glucanotransferase |
28 | 31 | 369 | -25.575 | 0.537 | Residual = 0.537 | | GAaAAaAA | ACAGTtTt | | DVU0703 DVU0757 DVU0786 DVU0807 DVU0808 DVU0840 DVU0867 DVU0868 DVU0869 DVU0871 DVU0906 DVU1044 DVU1208 DVU1210 DVU1240 DVU1247 DVU1538 DVU1621 DVU1788 DVU1789 DVU1790 DVU1791 DVU1890 DVU1897 DVU1898 DVU1949 DVU1951 DVU1952 DVU2343 DVU3243 DVU3365 | lepA trmU gatA ffh cdsA uppS pyrH lipB guaB plsX rpoD dnaG hemC glyS glyQ nifA-1 dnaJ fmt | GTP-binding protein LepA | hypothetical protein | penicillin-binding protein | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase | glutamyl-tRNA(Gln) amidotransferase, A subunit | signal recognition particle protein | aromatic amino acid decarboxylase, putative | phosphatidate cytidylyltransferase | undecaprenyl diphosphate synthase | uridylate kinase | lipoate-protein ligase B | inosine-5`-monophosphate dehydrogenase | fatty acid/phospholipid synthesis protein | RNA polymerase sigma-70 factor | DNA primase | MutS2 family protein | GatB/Yqey family protein | porphobilinogen deaminase | glycyl-tRNA synthetase, beta subunit | glycyl-tRNA synthetase subunit alpha | nif-specific regulatory protein | indolepyruvate ferredoxin oxidoreductase, alpha subunit, putative | amino acid ABC transporter, ATP-binding protein | dnaJ protein | methionyl-tRNA formyltransferase |
29 | 23 | 369 | -35.235 | 0.498 | Residual = 0.498 | | aCaccGAAgaGAAna | AtCtTAAAgTATA | | DVU0002 DVU0003 DVU0004 DVU0161 DVU0162 DVU0237 DVU0279 DVU0502 DVU0809 DVU0810 DVU1062 DVU1195 DVU1248 DVU1576 DVU1584 DVU1661 DVU1666 DVU1889 DVU1893 DVU2339 DVU3275 DVU3307 DVU3395 | dnaN gyrB gyrA purF carB serS gatC argS ispE efp gmhA ubiX | DNA polymerase III, beta subunit | DNA gyrase, B subunit | DNA gyrase, A subunit | amidophosphoribosyltransferase | carbamoyl-phosphate synthase, large subunit | seryl-tRNA synthetase | sulfate permease family protein | hypothetical protein | glutamyl-tRNA(Gln) amidotransferase, C subunit | lipoprotein, putative | arginyl-tRNA synthetase | 4-diphosphocytidyl-2C-methyl-D-erythritol kinase | sigma 70 family protein | translation elongation factor P | phosphoheptose isomerase | ATP-dependent protease, putative | ribosomal protein L11 methyltransferase, putative | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase | peptidase, M23/M37 family |
30 | 26 | 365 | -35.559 | 0.552 | Residual = 0.552 | | CCTGncgaancAGGgAGnGgaCTT | ATCTACCtTCTTCaCaTTCT | | DVU0052 DVU0176 DVU0637 DVU0730 DVU0885 DVU0911 DVU0930 DVU0931 DVU1009 DVU1178 DVU1332 DVU1362 DVU1363 DVU1364 DVU1365 DVU1366 DVU1850 DVU1950 DVU2052 DVU2053 DVU2054 DVU2055 DVU2464 DVU2889 DVU2896 DVU2938 | era truA proB thiD selD rfbD rfbB metG | GTP-binding protein Era | glycerophosphoryl diester phosphodiesterase family protein | hypothetical protein | amidohydrolase family protein | tRNA pseudouridine synthase A | gamma-glutamyl kinase | phosphomethylpyrimidine kinase | selenide, water dikinase, selenocysteine-containing | dTDP-4-dehydrorhamnose reductase | dTDP-glucose 4,6-dehydratase | heme-binding protein, putative | lipoprotein, putative | CBS domain protein | indolepyruvate ferredoxin oxidoreductase, beta subunit, putative | glycosyl transferase, group 2 family protein | methionyl-tRNA synthetase | BioY family protein | TPR domain protein |
31 | 26 | 365 | -38.762 | 0.500 | Residual = 0.500 | | AtGTttATTtTTTtncaatTgtA | cCaTgTtgTtaaAacAatCAcaAA | | DVU0025 DVU0109 DVU0139 DVU0294 DVU0317 DVU0445 DVU0578 DVU0717 DVU1079 DVU1228 DVU1230 DVU1231 DVU1232 DVU1295 DVU1534 DVU1535 DVU1563 DVU1654 DVU1731 DVU1872 DVU2040 DVU2268 DVU2989 DVU3132 DVU3269 DVU3385 | trmE tpX amt glnB-1 sat pspF | sensory box histidine kinase | sensor histidine kinase | glycosyl transferase, group 2 family protein | hypothetical protein | CBS domain protein | formate dehydrogenase accessory protein FdhD, putative | GGDEF domain/EAL domain protein | tRNA modification GTPase TrmE | thiol peroxidase | ammonium transporter | nitrogen regulatory protein P-II | sulfate adenylyltransferase | sensory box histidine kinase/response regulator | site-specific recombinase, phage integrase family | psp operon transcriptional activator | glycerol-3-phosphate dehydrogenase, FAD-dependent |
32 | 17 | 367 | -55.508 | 0.431 | Residual = 0.431 | | ATATGGTGCtTGcatCAAATGCAA | tTGcCccGaCGGAgATGAtG | | DVU0401 DVU0426 DVU0613 DVU0888 DVU0890 DVU0892 DVU0894 DVU0901 DVU0904 DVU0906 DVU0970 DVU1063 DVU2149 DVU2157 DVU2539 DVU2868 DVUA0151 | hom aroL aroC pyrF recJ lipB | hypothetical protein | chromate transport family protein | response regulator | homoserine dehydrogenase | shikimate kinase II | chorismate synthase | orotidine 5`-phosphate decarboxylase | single-stranded-DNA-specific exonuclease RecJ | lipoate-protein ligase B | lipoprotein, putative | transcriptional regulatory protein | tail tape meausure protein, putative | DNA-binding protein, putative |
33 | 29 | 365 | -32.475 | 0.491 | Residual = 0.491 | | ATAGGATAgTTCTT | TTGtCcTTTagCtTgGggtGTgT | | DVU0126 DVU0541 DVU0802 DVU0973 DVU0993 DVU1056 DVU1150 DVU1172 DVU1173 DVU1280 DVU1347 DVU1744 DVU1762 DVU1857 DVU1908 DVU1934 DVU2060 DVU2087 DVU2088 DVU2306 DVU2447 DVU2627 DVU2700 DVU2949 DVU3038 DVU3039 DVU3115 DVU3175 DVU3180 | mviN-1 pdxJ | ABC transporter, ATP-binding protein | lipoprotein, putative | hypothetical protein | 4-hydroxybenzoate octaprenyltransferase, putative | cobalt ABC transporter, ATP-binding protein, putative | integral membrane protein MviN | conserved hypothetical protein TIGR00159 | peptidase, M23/M37 family | DNA-binding protein | methyl-accepting chemotaxis protein | pyridoxal phosphate biosynthetic protein PdxJ | phosphonate ABC transporter, permease protein | phosphate transporter family protein | GGDEF domain protein |
34 | 21 | 374 | -64.728 | 0.438 | Residual = 0.438 | | AcaTTGAaAATCaTatTCAATA | ACACCAAtAtgCCGcgACATG | | DVU0273 DVU0303 DVU0304 DVU0762 DVU0763 DVU2377 DVU2378 DVU2381 DVU2383 DVU2564 DVU2571 DVU2572 DVU2573 DVU2574 DVU2680 DVU2681 DVU3124 DVU3330 DVU3331 DVU3332 DVU3333 | bioF feoB | hypothetical protein | GGDEF domain protein | transcriptional regulator, AraC family | tonB dependent receptor domain protein | 8-amino-7-oxononanoate synthase | ferrous iron transport protein B | ferrous iron transport protein A, putative | ferrous ion transport protein, putative | flavodoxin | heavy metal translocating P-type ATPase |
35 | 30 | 362 | -23.881 | 0.581 | Residual = 0.581 | | AGGAAAgCGAaACGGgAcaT | ctCCccGcCnGgCnncAaccC | | DVU0007 DVU0247 DVU0291 DVU0760 DVU0761 DVU0815 DVU0983 DVU1219 DVU1368 DVU1547 DVU2233 DVU2329 DVU2330 DVU2490 DVU2491 DVU2545 DVU2546 DVU2618 DVU2636 DVU2765 DVU2766 DVU2767 DVU2953 DVU3047 DVU3048 DVU3049 DVU3067 DVU3068 DVU3172 DVU3364 | asnC hypB asd hypF | asparaginyl-tRNA synthetase | response regulator | ABC transporter, ATP-binding protein | hypothetical protein | lipoprotein, putative | AsmA family protein | rhodanese-like domain protein | sensory box protein | hydrogenase accessory protein HypB | MRP family protein | histidinol phosphatase, putative | alcohol dehydrogenase, iron-containing | sensory box histidine kinase | metallo-beta-lactamase family protein | iron-sulfur flavoprotein, putative | transcriptional regulator, GntR family | aminotransferase, class IV | aspartate-semialdehyde dehydrogenase | hemerythrin family protein | [NiFe] hydrogenase maturation protein HypF | GAF domain/sensory box/EAL domain protein |
36 | 16 | 365 | -56.013 | 0.395 | Residual = 0.395 | | GGaCATGnCGc | CcTTcCCgGangCGT | | DVU0081 DVU0083 DVU0316 DVU0484 DVU0486 DVU0494 DVU0514 DVU0636 DVU1433 DVU1940 DVU2622 DVU2663 DVU2865 DVU3034 DVU3106 DVU3387 | flgB | sensory box histidine kinase/response regulator | hypothetical protein | flagellar basal body rod protein FlgB | ABC transporter, ATP-binding protein | aminotransferase, class V | FlgA family protein | response regulator/GGDEF domain protein | anaerobic glycerol-3-phosphate dehydrogenase, A subunit, putative | lipoprotein, putative | GGDEF domain protein |
37 | 38 | 368 | -19.586 | 0.566 | Residual = 0.566 | | ATTGCTATCGT | CATATGAtAGAAACC | | DVU0040 DVU0140 DVU0145 DVU0147 DVU0218 DVU0232 DVU0257 DVU0301 DVU0358 DVU0381 DVU0392 DVU0425 DVU0638 DVU0639 DVU0641 DVU1011 DVU1126 DVU1360 DVU1442 DVU1604 DVU1691 DVU1906 DVU1993 DVU2267 DVU2311 DVU2473 DVU2498 DVU2551 DVU2589 DVU2590 DVU2972 DVU3021 DVU3036 DVU3060 DVU3111 DVU3225 DVU3342 DVU3391 | nhaC-1 pomB galE | hypothetical protein | response regulator | lipoprotein, putative | tail protein, putative | acetyltransferase, GNAT family | Na+/H+ antiporter NhaC | aromatic aminotransferase | chemotaxis protein PomB | UDP-glucose 4-epimerase | flagellin FlaG, putative | cation-transporting ATPase, E1-E2 family | HD domain protein | sensory box protein | chemotaxis protein CheD, putative | HDIG domain protein | transcriptional regulator, Crp/Fnr family |
38 | 13 | 364 | -56.843 | 0.392 | Residual = 0.392 | | TCCGAtGaCGAAGg | gCCGGTGC | | DVU0031 DVU0180 DVU0636 DVU2732 DVU2829 DVU2830 DVU2848 DVU2852 DVU2854 DVU2856 DVU2868 DVUA0014 DVUA0066 | modC glnB-3 | AzlC family protein | molybdenum ABC transporter, ATP-binding protein | response regulator/GGDEF domain protein | hypothetical protein | tail fiber assembly protein, putative | tail protein, putative | nitrogen regulatory protein P-II | phospholipase, patatin family |
39 | 11 | 369 | -77.009 | 0.346 | Residual = 0.346 | | AaTCtTAAttA | AaaAncctGAaCaCTctanT | | DVU0008 DVU1164 DVU1754 DVU1967 DVU1968 DVU2191 DVU2194 DVU2278 DVU2480 DVU2690 DVU2691 | amiF | hypothetical protein | formamidase | transcriptional regulator, rrf2 protein, putative | oxidoreductase, putative |
40 | 7 | 370 | -118.423 | 0.314 | Residual = 0.314 | | atCctGACgAGcAGCtGaA | TGCGGGGCGGtgGTCtGGCgGTG | | DVU1122 DVU1123 DVU1124 DVU2611 DVU2695 DVU2704 DVU2713 | | portal protein, putative | hypothetical protein |
41 | 10 | 367 | -70.945 | 0.346 | Residual = 0.346 | | TGaCAAaA | TATAAA | | DVU0081 DVU0115 DVU0366 DVU1735 DVU2578 DVU2614 DVU2701 DVU2860 DVU2865 DVU3139 | aroE | sensory box histidine kinase/response regulator | shikimate 5-dehydrogenase | 5-formyltetrahydrofolate cyclo-ligase family protein | hypothetical protein | response regulator | lipoprotein, putative | bacterial extracellular solute-binding protein, family 3 |
42 | 10 | 369 | -75.205 | 0.348 | Residual = 0.348 | | TaTATTCAT | CGAAAcTCGAA | | DVU1716 DVU1718 DVU1741 DVU2003 DVU2160 DVU2163 DVU2164 DVU2170 DVU2542 DVU2832 | | hypothetical protein | transposase, IS5 family, truncation | lipoprotein, putative | minor capsid protein C | transcriptional regulator cII, putative |
43 | 11 | 373 | -78.058 | 0.386 | Residual = 0.386 | | ACGGACGcGAGTCgCATCCCGCCA | AAGGCCcGGCATGCG | | DVU1525 DVU1714 DVU1752 DVU2125 DVU2163 DVU2164 DVU2166 DVU2541 DVU2542 DVU2820 DVUA0143 | nifA-2 | hypothetical protein | TPR domain protein | lipoprotein, putative | holin | CoA-substrate-specific enzyme activase, putative | amidohydrolase family protein | Nif-specific regulatory protein |
44 | 17 | 366 | -22.710 | 0.526 | Residual = 0.526 | | ACgAgGAACaa | ATTTCTT | | DVU0065 DVU0066 DVU0087 DVU0136 DVU0285 DVU0504 DVU0505 DVU1691 DVU1756 DVU1806 DVU1833 DVU2274 DVU2305 DVU3099 DVU3100 DVU3101 DVUA0082 | hisH rpsO truB mgtE tolQ-2 | hypothetical protein | cytidine/deoxycytidylate deaminase domain protein | imidazole glycerol phosphate synthase subunit HisH | 30S ribosomal protein S15 | tRNA pseudouridine synthase B | magnesium transporter | phosphoenolpyruvate synthase, putative | tolQ protein | biopolymer transport protein, ExbD/TolR family | tonB protein, putative | site-specific recombinase, phage integrase family |
45 | 12 | 370 | -90.063 | 0.362 | Residual = 0.362 | | AAGGAttCtAcCCCcCaAA | CTTCtTTgGTgncGC | | DVU1303 DVU1325 DVU1326 DVU1327 DVU1328 DVU1329 DVU1330 DVU1574 DVU1575 DVU2518 DVU2924 DVU2926 | rplC rpmJ rpsM rpsK rpsD rpoA rplQ rplY prsA rplM rplK rplJ | 50S ribosomal protein L3 | 50S ribosomal protein L36 | 30S ribosomal protein S13 | 30S ribosomal protein S11 | 30S ribosomal protein S4 | DNA-directed RNA polymerase subunit alpha | 50S ribosomal protein L17 | 50S ribosomal protein L25/general stress protein Ctc | ribose-phosphate pyrophosphokinase | 50S ribosomal protein L13 | 50S ribosomal protein L11 | 50S ribosomal protein L10 |
46 | 28 | 357 | -26.592 | 0.561 | Residual = 0.561 | | tGCGAcaTnttTtTaCGAAaa | CCGACcaCGCaCCgC | | DVU0051 DVU0245 DVU0282 DVU0345 DVU0412 DVU0499 DVU0590 DVU0601 DVU0616 DVU1097 DVU1259 DVU1668 DVU1953 DVU2090 DVU2093 DVU2359 DVU2437 DVU2473 DVU2474 DVU2475 DVU2981 DVU2982 DVU2983 DVU2984 DVU2985 DVU3087 DVU3287 DVU3292 | mutY proA thiH + leuA leuD leuB cobH | conserved hypothetical protein TIGR00044 | protein phosphatase, putative | A/G-specific adenine glycosylase | hypothetical protein | potassium uptake protein TrkA, putative | conserved hypothetical protein TIGR00149 | phenylacetic acid degradation protein PaaI | outer membrane lipoprotein carrier protein, putative | gamma-glutamyl phosphate reductase | EF hand domain protein | thiamine biosynthesis protein ThiH | sigma-54 dependent transcriptional regulator | ABC transporter, permease protein | ferredoxin--NADP(+) reductase subunit alpha | 2-isopropylmalate synthase | 3-isopropylmalate dehydratase, large subunit | 3-isopropylmalate dehydratase, small subunit | 3-isopropylmalate dehydrogenase | precorrin-8X methylmutase | glycosyl transferase, group 2 family protein | pyridine nucleotide-disulfide oxidoreductase |
47 | 12 | 371 | -81.824 | 0.358 | Residual = 0.358 | | tGaCgctcGGcAcGncGnAAcg | TGtGgTctTTTgAcGTTCTgT | | DVU0016 DVU0545 DVU1712 DVU1716 DVU1754 DVU2192 DVU2278 DVU2327 DVU2426 DVU2832 DVUA0011 DVUA0056 | nifK | hypothetical protein | transcriptional regulator cII, putative | nitrogenase molybdenum-iron protein beta chain |
48 | 22 | 366 | -38.894 | 0.437 | Residual = 0.437 | | CTGAAAAG | CGGacATGATg | | DVU0079 DVU0128 DVU0327 DVU0413 DVU0441 DVU0612 DVU1019 DVU1242 DVU1458 DVU1590 DVU1611 DVU1813 DVU1814 DVU2243 DVU2409 DVU2484 DVU2485 DVU2762 DVU2787 DVU3255 DVU3261 DVU3375 | ade radA glgB frdC | ZIP zinc transporter family protein | hypothetical protein | exopolysaccharide biosynthesis protein, putative | potassium uptake protein, TrkH family | adenine deaminase | STAS domain protein | vacJ lipoprotein, putative | chemotaxis protein CheZ, putative | DNA repair protein RadA | molybdopterin oxidoreductase domain protein | cytochrome c oxidase, subunit III, putative | glycogen branching enzyme | bacterial extracellular solute-binding proteins, family 3 | cytochrome c family protein | transcriptional regulator, CopG family | fumarate reductase, cytochrome b subunit | cell division ATP-binding protein FtsE, putative |
49 | 1 | 361 | -147.536 | 1.000 | Residual = 1.000 | |
|
| | DVU0284 | ppiB-1 | peptidyl-prolyl cis-trans isomerase B |
50 | 10 | 362 | -33.293 | 0.558 | Residual = 0.558 | | TaatGtCaTgacAtCCgcCCC | AcgGCaAACGGgGcGaGGaGgAgG | | DVU0034 DVU0226 DVU0277 DVU0752 DVU0951 DVU2223 DVU2353 DVU3141 DVU3351 DVU3353 | queA coaBC | DSBA-like thioredoxin domain protein | hypothetical protein | transcriptional regulator, AraC family | amino acid ABC transporter, amino acid-binding protein | molybdopterin biosynthesis MoeA protein, putative | glycosyl transferase, group 2 family protein | lipoprotein, putative | S-adenosylmethionine:tRNA ribosyltransferase-isomerase | phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase |
51 | 12 | 361 | -25.922 | 0.560 | Residual = 0.560 | | tGtTgccaaaGTTgCAGGc | CggGgCcGCAcAagG | | DVU0272 DVU0379 DVU0393 DVU0568 DVU0972 DVU1546 DVU1667 DVU1983 DVU2303 DVU2466 DVU3189 DVU3236 | ung hflX | hypothetical protein | transcriptional regulator, putative | uracil-DNA glycosylase | tRNA 2-selenouridine synthase | HD domain protein | FtsK/SpoIIIE family protein | flocculin repeat domain | NOL1/NOP2/sun family protein | GTP-binding protein HflX |
52 | 19 | 357 | -26.448 | 0.515 | Residual = 0.515 | | tTTCagGAGgA | GtTtTTCt | | DVU0397 DVU0642 DVU0842 DVU0952 DVU1001 DVU1045 DVU1047 DVU1050 DVU1282 DVU1286 DVU1864 DVU1865 DVU1919 DVU1928 DVU2368 DVU2943 DVU3191 DVU3210 DVU3281 | ccmC ccmF glmM lspA fabZ pyrE rluC thrC | rare lipoprotein A, putative | hydrolase, alpha/beta fold family | hypothetical protein | conserved hypothetical protein TIGR00282 | coenzyme A binding protein | cytochrome c-type biogenesis protein CcmC | cytochrome c-type biogenesis protein CcmF | phosphoglucosamine mutase | reductase, transmembrane subunit, putative | DNA-binding protein HU, beta subunit, putative | hydrogenase expression/formation protein, putative | lipoprotein signal peptidase | beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ | orotate phosphoribosyltransferase | ribosomal large subunit pseudouridine synthase C | threonine synthase |
53 | 27 | 375 | -35.753 | 0.494 | Residual = 0.494 | | ATaagaaAAATtAaTgTTtGA | gCAgccgaCAcaGgGacAG | | DVU0146 DVU0147 DVU0148 DVU0149 DVU0150 DVU0152 DVU0372 DVU0458 DVU0593 DVU0594 DVU0678 DVU0751 DVU0805 DVU0806 DVU0882 DVU1670 DVU2014 DVU2061 DVU2088 DVU2104 DVU2952 DVU3125 DVU3182 DVU3188 DVU3384 DVUA0036 DVUA0061 | iciA pfkA dcrA zraP | hypothetical protein | lipoprotein, putative | phosphoenolpyruvate synthase-related protein | L-lysine exporter, putative | chromosome replication initiation inhibitor protein | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | chemotaxis protein CheY, putative | metallo-beta-lactamase family protein | diphosphate--fructose-6-phosphate 1-phosphotransferase | iron-sulfur cluster-binding/ATPase domain protein | methyl-accepting chemotaxis protein DcrA | NLP/P60 family protein | zinc resistance-associated protein | TPR domain protein |
54 | 26 | 365 | -28.423 | 0.570 | Residual = 0.570 | | AtATTtcAGAAAGtTACA | TCTcTCTTTnTGttAcGC | | DVU0236 DVU0415 DVU0462 DVU0463 DVU0464 DVU0465 DVU0466 DVU0467 DVU0468 DVU0469 DVU0470 DVU0471 DVU0905 DVU0908 DVU0943 DVU0944 DVU0946 DVU1017 DVU1018 DVU1020 DVU1141 DVU1847 DVU2052 DVU2056 DVU2144 DVU3102 | pepA aroA trpG trpD trpC trpF-1 trpB-2 trpA lipA gap-2 | site-specific recombinase, phage integrase family | cytosol aminopeptidase | chorismate mutase/prephenate dehydratase | 3-phosphoshikimate 1-carboxyvinyltransferase | prephenate dehydrogenase | anthranilate synthase, component I | anthranilate synthase, glutamine amidotransferase component | anthranilate phosphoribosyltransferase | indole-3-glycerol phosphate synthase | N-(5'-phosphoribosyl)anthranilate isomerase | tryptophan synthase subunit beta | tryptophan synthase subunit alpha | lipoyl synthase | iron-sulfur cluster-binding protein, putative | hypothetical protein | sigma-54 dependent transcriptional regulator/response regulator | ABC transporter, ATP-binding protein/permease protein | type I secretion membrane fusion protein, HlyD family | HD domain/sensory box protein | glycosyl transferase, group 2 family protein | glyceraldehyde 3-phosphate dehydrogenase |
55 | 17 | 360 | -29.008 | 0.531 | Residual = 0.531 | | CCGTAcctCtctcAtGcCG | GTGGaTGCCGtgcCG | | DVU0277 DVU0347 DVU0397 DVU0734 DVU0736 DVU0872 DVU1086 DVU1087 DVU2238 DVU2613 DVU2734 DVU2891 DVU2943 DVU2944 DVU3061 DVU3201 DVU3274 | purN nikR pyrE | transcriptional regulator, AraC family | transferase, hexapeptide repeat family | rare lipoprotein A, putative | uroporphyrinogen III synthase/methyltransferase | phosphoribosylglycinamide formyltransferase | glycosyl transferase, group 2 family protein | hypothetical protein | RNA methyltransferase, TrmH family | nickel responsive regulator | orotate phosphoribosyltransferase | ErfK/YbiS/YcfS/YnhG family protein | sensory box histidine kinase |
56 | 23 | 363 | -42.552 | 0.483 | Residual = 0.483 | | GTCTTgGAAGgcAAaGTaAGC | TGTgngcGTaTGggnTTtcTGCT | | DVU0054 DVU0153 DVU0157 DVU0502 DVU0792 DVU0879 DVU0880 DVU0886 DVU1087 DVU1407 DVU1409 DVU1576 DVU1663 DVU1664 DVU1665 DVU1666 DVU1954 DVU2300 DVU2340 DVU3054 DVU3149 DVU3150 DVU3186 | thiL ispE aroQ efp nadD sppA rpsA | dihydrouridine synthase family protein | hypothetical protein | thiamin-monophosphate kinase | thioesterase family protein | radical SAM domain protein | 4-diphosphocytidyl-2C-methyl-D-erythritol kinase | permease, putative | GTPase EngB | 3-dehydroquinate dehydratase | translation elongation factor P | nicotinate (nicotinamide) nucleotide adenylyltransferase | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | signal peptide peptidase SppA, 36K type | 30S ribosomal protein S1 |
57 | 33 | 365 | -30.454 | 0.515 | Residual = 0.515 | | CaCcaccGaTGttatAcGGaAagC | TTgTCcGGGGTGGC | | DVU0159 DVU0160 DVU0243 DVU0417 DVU0483 DVU0801 DVU0855 DVU0856 DVU0864 DVU0982 DVU0985 DVU0989 DVU1091 DVU1191 DVU1193 DVU1380 DVU1381 DVU1383 DVU1401 DVU1432 DVU1434 DVU1466 DVU1580 DVU2261 DVU2621 DVU2639 DVU2909 DVU3202 DVU3283 DVU3314 DVU3357 DVU3358 DVU3359 | speA uvrC hemB radC argB | thioesterase family protein | carbohydrate isomerase, KpsF/GutQ family | lipoprotein, putative | arginine decarboxylase | DNA mismatch repair protein MutL, putative | excinuclease ABC, C subunit | radical SAM domain protein | delta-aminolevulinic acid dehydratase | glycoprotease family protein, putative | hypothetical protein | periplasmic divalent cation tolerance protein cutA, putative | ATP-dependent protease La, putative | DNA repair protein RadC | acetylglutamate kinase | ribose 5-phosphate isomerase, putative | transcriptional regulator, MarR family | hydrolase, TatD family | peptidase, U32 family | ParA family protein |
58 | 20 | 366 | -60.930 | 0.378 | Residual = 0.378 | | GTGAGC | TCCGTTTCT | | DVU0197 DVU0206 DVU0207 DVU0209 DVU0210 DVU0211 DVU0212 DVU0214 DVU0216 DVU0217 DVU0219 DVU2850 DVU2851 DVU2853 DVU2857 DVU2858 DVU2859 DVU2860 DVU2861 DVU2864 | | phage portal protein, lambda family | hypothetical protein | tail sheath protein, putative | tail tube protein, putative | tail/DNA circulation protein, putative | phage baseplate assembly protein V, putative | tail protein, putative |
59 | 10 | 371 | -99.293 | 0.311 | Residual = 0.311 | | GCGTcGcaGCCGTGG | TTaCacAtGGC | | DVU0860 DVU0889 DVU2122 DVU2125 DVU2129 DVU2154 DVU2156 DVU2170 DVU2172 DVU3285 | | hypothetical protein | phosphonopyruvate decarboxylase-related protein | type II/IV secretion system protein | TPR domain protein | sensory box histidine kinase/response regulator | tail assembly protein, putative | minor capsid protein C |
60 | 29 | 370 | -25.650 | 0.550 | Residual = 0.550 | | ACATAGAGAGAGGTTACAAAAGAT | ATgTacggGaAAATcCacA | | DVU0019 DVU0276 DVU0423 DVU0490 DVU0565 DVU0566 DVU0773 DVU0881 DVU0882 DVU0883 DVU0974 DVU0979 DVU0995 DVU1283 DVU1397 DVU1422 DVU1528 DVU1529 DVU1541 DVU2212 DVU2349 DVU2427 DVU3042 DVU3183 DVU3184 DVU3185 DVU3293 DVU3355 DVU3392 | ngr gap-1 galU bfr rbO roO glnA | nigerythrin | hypothetical protein | universal stress protein family | glyceraldehyde 3-phosphate dehydrogenase | GAF domain protein | elongation factor G | glutaredoxin, putative | dihydroxyacetone kinase subunit DhaK | ThiJ/PfpI family protein | UTP-glucose-1-phosphate uridylyltransferase | bacterioferritin | OmpA family protein | cytidine/deoxycytidylate deaminase family protein | decarboxylase family protein | carbohydrate phosphorylase family protein | lipoprotein, putative | desulfoferrodoxin | rubredoxin | rubredoxin-oxygen oxidoreductase | acetolactate synthase | SPFH domain/Band 7 family protein | glutamine synthetase, type I |
61 | 20 | 370 | -49.819 | 0.487 | Residual = 0.487 | | AcCGcAcTCGTgta | CtCCTTnnGcGGcnanGgGgnCGa | | DVU0429 DVU0431 DVU0433 DVU0434 DVU3286 DVUA0001 DVUA0002 DVUA0003 DVUA0021 DVUA0022 DVUA0024 DVUA0035 DVUA0046 DVUA0047 DVUA0064 DVUA0083 DVUA0092 DVUA0146 DVUA0148 DVUA0149 | | Ech hydrogenase, subunit EchF, putative | Ech hydrogenase, subunit EchD, putative | Ech hydrogenase, subunit EchB, putative | Ech hydrogenase, subunit EchA, putative | hypothetical protein | ParA family protein | ABC transporter, ATP-binding protein | sigma-54 interaction domain protein | glycosyl transferase, group 2 family protein | major facilitator superfamily protein |
62 | 27 | 369 | -22.768 | 0.584 | Residual = 0.584 | | aattTnatGCgAGCCCTAnAGT | tTAcAAaGATcATTTTaT | | DVU0247 DVU0250 DVU0319 DVU0325 DVU0349 DVU0394 DVU0499 DVU0523 DVU0524 DVU0800 DVU1670 DVU1868 DVU1953 DVU2042 DVU2082 DVU2203 DVU2446 DVU2475 DVU2735 DVU2756 DVU2883 DVU2884 DVU2897 DVU2948 DVU3068 DVU3208 DVU3364 | hypD flgM dapA proA panB + paaK-3 selA | response regulator | hypothetical protein | NAD-dependent epimerase/dehydratase family protein | hydrogenase expression/formation protein HypD | NeuB family protein | radical SAM domain protein | conserved hypothetical protein TIGR00149 | negative regulator of flagellin synthesis FlgM | dihydrodipicolinate synthase | gamma-glutamyl phosphate reductase | Fic family protein | flagellin, putative | endoribonuclease, L-PSP family | 3-methyl-2-oxobutanoate hydroxymethyltransferase | ferredoxin--NADP(+) reductase subunit alpha | phenylacetate-coenzyme A ligase | selenocysteine synthase | putative aminopeptidase 1 | bacterial flagellin N-terminal domain protein | GAF domain/sensory box/EAL domain protein |
63 | 27 | 368 | -34.160 | 0.470 | Residual = 0.470 | | aaGacaCcAcAgGAtAGGAg | GGAGgCATGAC | | DVU0034 DVU0056 DVU0227 DVU0334 DVU0395 DVU0454 DVU0575 DVU0619 DVU0620 DVU0656 DVU0854 DVU1090 DVU1408 DVU1434 DVU1537 DVU1579 DVU1616 DVU1820 DVU1877 DVU1888 DVU2471 DVU2612 DVU2639 DVU2644 DVU3281 DVU3345 DVU3359 | cheV-1 recA cysS yajC | DSBA-like thioredoxin domain protein | chemotaxis protein CheV | hypothetical protein | D-alanine--D-alanine ligase | HIT family protein | sigma-54 dependent transcriptional regulator | endoribonuclease, L-PSP family | NirD protein, putative | recombinase A | lipoprotein, putative | cysteinyl-tRNA synthetase | preprotein translocase, YajC subunit | polysaccharide deacetylase family protein | ATP-NAD kinase domain protein | oxidoreductase, selenocysteine-containing | transcriptional regulator, GntR family |
64 | 21 | 372 | -39.442 | 0.476 | Residual = 0.476 | | ACCGCAAtATCAAGgAggGAG | TTCcGTtGacGCGtGccGTgCG | | DVU0002 DVU0003 DVU0285 DVU0501 DVU0505 DVU0830 DVU0831 DVU1042 DVU1043 DVU1078 DVU1249 DVU1250 DVU1274 DVU1841 DVU2225 DVU2332 DVU2333 DVU2536 DVU2904 DVU3090 DVU3245 | dnaN gyrB hisH truB ptsH tatB guaA fabD gidB fbp proC ndk rpmI greA | DNA polymerase III, beta subunit | DNA gyrase, B subunit | imidazole glycerol phosphate synthase subunit HisH | hypothetical protein | tRNA pseudouridine synthase B | phosphocarrier protein HPr | PTS system, IID component, putative | twin-arginine translocation protein TatB | bifunctional GMP synthase/glutamine amidotransferase protein | R3H domain protein | malonyl CoA-acyl carrier protein transacylase | methyltransferase GidB | fructose-1,6-bisphosphatase | acetyl-CoA carboxylase, carboxyl transferase, alpha/beta subunit | pyrroline-5-carboxylate reductase | nucleoside diphosphate kinase | 50S ribosomal protein L35 | radical SAM enzyme, Cfr family | outer membrane protein, OMPP1/FadL/TodX family | transcription elongation factor GreA |
65 | 31 | 367 | -30.525 | 0.557 | Residual = 0.557 | | GAaTCGGCATCGTATgacA | cATGggGgATGTtCCggCggcAg | | DVU0182 DVU0286 DVU0333 DVU0703 DVU0868 DVU0871 DVU0988 DVU0990 DVU0991 DVU1054 DVU1071 DVU1196 DVU1197 DVU1214 DVU1215 DVU1251 DVU1272 DVU1273 DVU1275 DVU1352 DVU1353 DVU1395 DVU1599 DVU1621 DVU1878 DVU1879 DVU1907 DVU2135 DVU2224 DVU2258 DVU3066 | hisF lepA cdsA pyrH leuS nusB dnaE crcB ltaE ugd ruvC | radical SAM domain protein | imidazoleglycerol phosphate synthase, cyclase subunit | hypothetical protein | GTP-binding protein LepA | phosphatidate cytidylyltransferase | uridylate kinase | carbohydrate kinase, PfkB family | endonuclease III, putative | hydrolase, HAD-superfamily, subfamily IIIA | leucyl-tRNA synthetase | N utilization substance protein B | dolichyl-phosphate-mannose-protein mannosyltransferase family protein | PAP2 family protein | general secretion pathway protein E, putative | bacterial type II/III secretion system protein | 6-pyruvoyl tetrahydrobiopterin synthase, putative | DNA polymerase III, alpha subunit | C4-type zinc finger protein, DksA/TraR family | crcB protein | threonine aldolase, low-specificity | glycosyl transferase, group 1 family protein | UDP-glucose 6-dehydrogenase | crossover junction endodeoxyribonuclease RuvC | DNA-binding protein |
66 | 14 | 365 | -46.587 | 0.426 | Residual = 0.426 | | cCGgaAncGtCAnGG | GCaaACAg | | DVU0416 DVU1192 DVU1987 DVU2089 DVU2100 DVU2108 DVU2362 DVU2363 DVU2440 DVU2487 DVU2488 DVU3315 DVU3381 DVU3382 | uvrA thiE thiM pyrK zraS | GGDEF domain protein | acylphosphatase | excinuclease ABC, A subunit | hypothetical protein | universal stress protein family | thiamine-phosphate pyrophosphorylase | hydroxyethylthiazole kinase | dihydroorotate dehydrogenase, electron transfer subunit | transcriptional regulatory protein zraR | sensor protein ZraS |
67 | 13 | 363 | -41.948 | 0.491 | Residual = 0.491 | | TTccgCATgTnCTC | TGtTgnnTantgTtnTnGCCacCa | | DVU0028 DVU1127 DVU1161 DVU1779 DVU1998 DVU2187 DVU2253 DVU2812 DVU3044 DVU3160 DVU3214 DVU3260 DVU3329 | csaA fdnG-3 | chaperone CsaA | hypothetical protein | formate dehydrogenase, alpha subunit, selenocysteine-containing | phosphoenolpyruvate synthase-related protein |
68 | 28 | 367 | -27.969 | 0.561 | Residual = 0.561 | | TcGCgtCAT | CGaATcCGTCAAaggtAgTG | | DVU0058 DVU0098 DVU0367 DVU0368 DVU0373 DVU0429 DVU0431 DVU0432 DVU0433 DVU0434 DVU0436 DVU0437 DVU0706 DVU1421 DVU1546 DVU1737 DVU2099 DVU2147 DVU2228 DVU2665 DVU2679 DVU2750 DVU3264 DVUA0002 DVUA0003 DVUA0004 DVUA0125 DVUA0144 | potA cbiD | efflux transporter, RND family, MFP subunit | putrescine/spermidine ABC transporter ATPase protein | Ser/Thr protein phosphatase family protein | hypothetical protein | CoA-binding domain protein | Ech hydrogenase, subunit EchF, putative | Ech hydrogenase, subunit EchD, putative | Ech hydrogenase, subunit EchC, putative | Ech hydrogenase, subunit EchB, putative | Ech hydrogenase, subunit EchA, putative | transcriptional regulator, TetR family | TRAP transporter, DctQ subunit | carbon monoxide dehydrogenase accessory protein CooC, putative | L-serine dehydratase, putative | motB protein, putative | phosphate ABC transporter, permease protein, putative | sensory box histidine kinase/response regulator | cobalamin biosynthesis protein CbiD | fumarate hydratase | ParA family protein | DNA-binding protein HU, putative | transglycosylase, SLT family |
69 | 39 | 357 | -20.472 | 0.531 | Residual = 0.531 | | TTCaTtcTctTttcggGTCgCgca | ATGACa | | DVU0038 DVU0088 DVU0101 DVU0104 DVU0236 DVU0249 DVU0257 DVU0345 DVU0859 DVU1036 DVU1113 DVU1165 DVU1213 DVU1269 DVU1389 DVU1391 DVU1435 DVU1958 DVU2234 DVU2276 DVU2366 DVU2408 DVU2461 DVU2465 DVU2520 DVU2570 DVU2594 DVU2660 DVU2700 DVU2780 DVU2823 DVU2908 DVU2910 DVU2953 DVU2954 DVU2955 DVU3017 DVU3040 DVU3386 | panF | acyltransferase domain protein | sodium/panthothenate symporter | methlytransferase, UbiE/COQ5 family | cation ABC transporter, permease protein, putative | site-specific recombinase, phage integrase family | hypothetical protein | acetyltransferase, GNAT family | pyridine nucleotide-disulfide oxidoreductase | rhomboid family protein | sensory box histidine kinase | conserved hypothetical protein TIGR00275 | oligopeptide ABC transporter, permease protein | GGDEF domain/HAMP domain protein | TRAP transporter, DctMQ subunit | transcriptional regulator, GntR family | GGDEF domain protein | permease, putative |
70 | 16 | 359 | -36.701 | 0.507 | Residual = 0.507 | | TTTgaTnGncTctACAaAAa | tTcTnGtGtT | | DVU0382 DVU0476 DVU0542 DVU0543 DVU0544 DVU0673 DVU0921 DVU1085 DVU1379 DVU1481 DVU2151 DVU2152 DVU2199 DVU2213 DVU3129 DVU3317 | phoU | hypothetical protein | universal stress protein family | 5-nitroimidazole antibiotic resistance protein, putative | phosphate transport system protein PhoU | nuclease domain protein |
71 | 26 | 368 | -36.665 | 0.480 | Residual = 0.480 | | AgCAtgAATGGAtaTGaAg | TGacgcTcTcGAAaTaACncCTT | | DVU0275 DVU0276 DVU0453 DVU0565 DVU0566 DVU0754 DVU0938 DVU1180 DVU1244 DVU1449 DVU1450 DVU1471 DVU1528 DVU1529 DVU1656 DVU1867 DVU2059 DVU2060 DVU2427 DVU2684 DVU2770 DVU2840 DVU2935 DVU2937 DVU3226 DVU3227 | gap-1 folK dapF gpm | polysaccharide deacetylase family protein | hypothetical protein | ATP-dependent DNA helicase, UvrD/REP family | glyceraldehyde 3-phosphate dehydrogenase | GAF domain protein | isoamylase N-terminal domain protein | anti-anti-sigma factor, putative | anti-sigma factor, putative | heat shock protein, Hsp20 family | cytidine/deoxycytidylate deaminase family protein | decarboxylase family protein | 2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase | diaminopimelate epimerase | glycosyl transferase, group 2 family protein | response regulator | phosphoglycerate mutase | TPR domain protein/response regulator receiver domain protein | flagellar basal body-associated protein, putative |
72 | 11 | 372 | -94.994 | 0.311 | Residual = 0.311 | | AcGGAGAtGAC | TTnctTTnatnttCtGTTt | | DVU0375 DVU0860 DVU0889 DVU1115 DVU1733 DVU1740 DVU2158 DVU2611 DVU2695 DVU2740 DVUA0011 | livF nifK | Glu/Leu/Phe/Val dehydrogenase family protein | hypothetical protein | phosphonopyruvate decarboxylase-related protein | high-affinity branched-chain amino acid ABC transporter, ATP-binding protein | nitrogenase molybdenum-iron protein beta chain |
73 | 12 | 372 | -68.947 | 0.364 | Residual = 0.364 | | GCAcAtTgCaCA | AAATTC | | DVU1114 DVU1715 DVU1717 DVU1719 DVU1720 DVU1723 DVU1725 DVU2166 DVU2171 DVU2185 DVU2597 DVU2789 | | virion morphogenesis protein | hypothetical protein | holin | portal protein | terminase, large subunit, putative | Gpr1/Fun34/YaaH family protein |
74 | 25 | 372 | -66.245 | 0.414 | Residual = 0.414 | | cTTGTgCtaaAAtTCAcAa | ATCaaCaTAAGgCga | | DVU0692 DVU0693 DVU0694 DVU0774 DVU0775 DVU0776 DVU0777 DVU0779 DVU0780 DVU0845 DVU0846 DVU0847 DVU0848 DVU0849 DVU0850 DVU0851 DVU0917 DVU0918 DVU0919 DVU1264 DVU1294 DVU1295 DVU1296 DVU1636 DVU1932 | atpC atpD atpG atpA aprB aprA atpE atpB sat ppaC adk | molybdopterin oxidoreductase, transmembrane subunit, putative | molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative | molybdopterin oxidoreductase, molybdopterin-binding subunit, putative | ATP synthase, F1 epsilon subunit | F0F1 ATP synthase subunit beta | ATP synthase, F1 gamma subunit | F0F1 ATP synthase subunit alpha | ATP synthase F0, B subunit, putative | ATP synthase F0, B' subunit, putative | hypothetical protein | adenylylsulphate reductase, beta subunit | adenylylsulfate reductase | heterodisulfide reductase, putative | heterodisulfide reductase, iron-sulfur-binding subunit, putative | heterodisulfide reductase, transmembrane subunit, putative | ATP synthase F0, C subunit | ATP synthase F0, A subunit | transglycosylase SLT domain protein | sulfate adenylyltransferase | putative manganese-dependent inorganic pyrophosphatase | adenylate kinase |
75 | 26 | 369 | -36.152 | 0.508 | Residual = 0.508 | | cTGTtgCATCcgaCGCCCCgtGgc | tTTTTCtagAtGTC | | DVU0450 DVU0451 DVU0746 DVU0784 DVU0785 DVU0787 DVU0895 DVU1026 DVU1092 DVU1346 DVU1349 DVU1355 DVU1357 DVU1797 DVU1798 DVU1806 DVU1808 DVU1809 DVU1928 DVU1935 DVU1936 DVU2254 DVU2255 DVU2339 DVU2931 DVU3165 | ribF rodA uraA xseA ksgA mgtE nadA nadB lspA thyX ruvB | riboflavin biosynthesis protein RibF | chloride channel family protein | ABC transporter, permease protein | hypothetical protein | rod shape-determining protein RodA | helicase, RecD/TraA family | uracil permease | sodium-dependent symporter family protein | exodeoxyribonuclease VII, large subunit | geranylgeranyl diphosphate synthase | dimethyladenosine transferase | magnesium transporter | quinolinate synthetase | L-aspartate oxidase | lipoprotein signal peptidase | phosphonate ABC transporter, permease protein | phosphonate ABC transporter, ATP-binding protein | FAD-dependent thymidylate synthase | Holliday junction DNA helicase B | ribosomal protein L11 methyltransferase, putative | sensory box histidine kinase |
76 | 19 | 368 | -42.339 | 0.595 | Residual = 0.595 | | CCTctGtgGTGtCaTCggggTGCA | ATaCTaCTTGCtTTTCAcaaGG | | DVU0978 DVU1469 DVU2152 DVU2269 DVU2352 DVU2603 DVU2605 DVU2606 DVU3230 DVU3231 DVU3298 DVU3299 DVU3300 DVU3301 DVU3302 DVU3303 DVU3304 DVU3305 DVU3360 | rpsA | ABC transporter, periplasmic substrate-binding protein, putative | 30S ribosomal protein S1 | hypothetical protein | glycosyl transferase, group 2 family protein | flagellar synthesis regulator FleN | flagellar biosynthesis protein FlhF, putative | ATP-dependent protease La, truncation | sigma-54 dependent transcriptional regulator/response regulator | ParB family protein |
77 | 28 | 375 | -24.842 | 0.574 | Residual = 0.574 | | caATcAtGgAaanA | GaAAaATaAT | | DVU0018 DVU0330 DVU0331 DVU0591 DVU0592 DVU0700 DVU1552 DVU1559 DVU1570 DVU2020 DVU2075 DVU2077 DVU2118 DVU2119 DVU2121 DVU2126 DVU2281 DVU2481 DVU2483 DVU2524 DVU2525 DVU2526 DVU2626 DVU3133 DVU3134 DVU3246 DVU3247 DVU3265 | cheW-1 mop porB hynB-2 hynA-2 glpK | methyl-accepting chemotaxis protein, putative | response regulator | sensory box histidine kinase, putative | methyl-accepting chemotaxis protein | chemotaxis protein CheW | hypothetical protein | aldehyde oxidoreductase | pyruvate ferredoxin oxidoreductase, beta subunit | ParA family protein | type II/III secretion system protein | sensor histidine kinase/response regulator | formate dehydrogenase, beta subunit, putative | cytochrome c family protein | cytochrome c3, putative | periplasmic [NiFe] hydrogenase, small subunit, isozyme 2 | periplasmic [NiFe] hydrogenase, large subunit, isozyme 2 | glycerol uptake facilitator protein | glycerol kinase | RND efflux system, outer membrane protein, NodT family | efflux transporter, RND family, MFP subunit | tartrate dehydratase beta subunit, putative |
78 | 24 | 362 | -40.390 | 0.503 | Residual = 0.503 | | TAGCAcCaaAgGcGGCGGatGTAA | tCaaGaCaAaCGgtGcaaGGc | | DVU0014 DVU0054 DVU0105 DVU0158 DVU0196 DVU0415 DVU0793 DVU0895 DVU0896 DVU1008 DVU1033 DVU1041 DVU1074 DVU1245 DVU1533 DVU1893 DVU2206 DVU2222 DVU2223 DVU2225 DVU2229 DVU2230 DVU2341 DVU3056 | infA-1 pepA tatC rpmH miaA ssb motA-2 deoD | translation initiation factor IF-1 | dihydrouridine synthase family protein | glutamine ABC transporter, ATP-binding protein | conserved hypothetical protein TIGR00104 | hypothetical protein | cytosol aminopeptidase | helicase, RecD/TraA family | lipoprotein, NLP/P60 family | competence/damage-inducible protein CinA protein, truncation | Sec-independent protein translocase TatC | ribosomal protein L34 | ABC transporter, ATP-binding protein | tRNA delta(2)-isopentenylpyrophosphate transferase | ATP-dependent protease, putative | single-strand binding protein | acetyl-CoA carboxylase, carboxyl transferase, alpha/beta subunit | chemotaxis protein MotA | purine nucleoside phosphorylase | amino acid ABC transproter, permease protein, His/Glu/Gln/Arg/opine family |
79 | 10 | 371 | -86.744 | 0.351 | Residual = 0.351 | | ACCgaGGggnTtttCtTgtAa | gCaTcaAAaCg | | DVU0824 DVU1417 DVU1493 DVU1702 DVU1761 DVU1870 DVU1871 DVU2167 DVU2719 DVU2724 | aspA | hypothetical protein | cyclase, putative | aspartate ammonia-lyase | phage baseplate assembly protein V, putative |
80 | 14 | 367 | -81.883 | 0.349 | Residual = 0.349 | | aCaAGnacgAcaCcnCggAcgAAA | AAaTCAAGgAAGcCGGAcTT | | DVU1053 DVU1107 DVU1162 DVU1417 DVU1504 DVU1513 DVU1515 DVU1516 DVU1969 DVU2604 DVU2645 DVU2647 DVU2720 DVU3139 | | hypothetical protein | tail tape measure protein | terminase, small subunit | type II DNA modification methyltransferase, putative | Na+/H+ antiporter family protein | endoribonuclease, L-PSP family | bacterial extracellular solute-binding protein, family 3 |
81 | 29 | 362 | -30.497 | 0.545 | Residual = 0.545 | | CATAcgGCAgGACAG | TGCcCCCGgtAGCAgTcCCgC | | DVU0027 DVU0097 DVU0296 DVU0336 DVU0337 DVU0339 DVU0340 DVU0342 DVU0343 DVU0344 DVU1609 DVU1912 DVU2370 DVU2447 DVU2448 DVU2449 DVU2530 DVU2898 DVU2947 DVU3065 DVU3119 DVU3181 DVU3233 DVU3234 DVU3235 DVU3347 DVU3371 DVU3373 DVU3374 | potB dapB panC metK tkt purL flhB metE ilvD | hypothetical protein | polyamine ABC transporter, permease protein | peptidase, M24 family | aminotransferase, DegT/DnrJ/EryC1/StrS family | D-isomer specific 2-hydroxyacid dehydrogenase family protein | acetyltransferase, CysE/LacA/LpxA/NodL family | NAD-dependent epimerase/dehydratase family protein | HPCH/HPAI aldolase family protein | methyl-accepting chemotaxis protein | dihydrodipicolinate reductase | conserved hypothetical protein TIGR00150 | outer membrane protein OmpH, putative | pantoate--beta-alanine ligase | S-adenosylmethionine synthetase | transketolase | anaerobic ribonucleoside triphosphate reductase | acyl-CoA synthetase | AMP-binding enzyme family protein | phosphoribosylformylglycinamidine synthase II | flagellar biosynthesis protein FlhB | flagellar biosynthetic protein FliR | IMP cyclohydrolase, putative | pyruvate ferredoxin/flavodoxin oxidoreductase family protein | 5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase | dihydroxy-acid dehydratase | permease, putative |
82 | 29 | 370 | -23.934 | 0.598 | Residual = 0.598 | | AgaCAACgaCCaacgCAAgGAaaC | GCgGAAGGCccgCtgGCGtC | | DVU0066 DVU0099 DVU0117 DVU0119 DVU0120 DVU0171 DVU0440 DVU0496 DVU0643 DVU0687 DVU0689 DVU0826 DVU0829 DVU0858 DVU1079 DVU1261 DVU1268 DVU1573 DVU2115 DVU2591 DVU2661 DVU2733 DVU2822 DVU2824 DVU3057 DVU3058 DVU3236 DVU3258 DVU3326 | polA rnhA ptsI trmE pth hflX murA | cytidine/deoxycytidylate deaminase domain protein | TonB domain protein | glycosyl transferase, group 2 family protein | sensor histidine kinase | ABC transporter, substrate-binding protein, putative | hemolysin-related protein | hypothetical protein | DNA polymerase I | thiF protein, putative | aldehyde:ferredoxin oxidoreductase, tungsten-containing, putative | ribonuclease HI | glycolate oxidase, iron-sulfur subunit, putative | phosphoenolpyruvate-protein phosphotransferase | lipoprotein, putative | tRNA modification GTPase TrmE | peptidyl-tRNA hydrolase | tail fiber assembly protein, putative | twin-arginine translocation pathway signal sequence domain protein | adenine specific DNA methyltransferase, putative | TRAP transporter solute receptor DctP | formate acetyltransferase | oxygen-independent coproporphyrinogen III oxidase, putative | sensory box histidine kinase/response regulator | GTP-binding protein HflX | UDP-N-acetylglucosamine 1-carboxyvinyltransferase | multidrug resistance protein, Smr family |
83 | 31 | 369 | -22.946 | 0.520 | Residual = 0.520 | | gcGgTGtCAtG | TTcTTTAATTAAA | | DVU0005 DVU0082 DVU0258 DVU0271 DVU0635 DVU0652 DVU0686 DVU0742 DVU0946 DVU0947 DVU0969 DVU0973 DVU0998 DVU1007 DVU2244 DVU2357 DVU2418 DVU2635 DVU2638 DVU2759 DVU2900 DVU2905 DVU2976 DVU2993 DVU3015 DVU3086 DVU3222 DVU3224 DVU3278 DVU3295 DVU3320 | cheV-2 cobU glgA cobB-2 pgi sfsA | lipoprotein, putative | hypothetical protein | sensory box histidine kinase/response regulator | response regulator | dolichyl-phosphate-mannose-protein mannosyltransferase family protein | chemotaxis protein CheV | iron-sulfur cluster-binding protein | sigma-54 dependent transcriptional regulator/response regulator | efflux protein, LysE family | 4-hydroxybenzoate octaprenyltransferase, putative | heptosyltransferase family protein | cobinamide kinase/cobinamide phosphate guanylyltransferase | glycogen synthase | HD domain protein | vanZ-like family protein | glycosyl transferase, group 1 family protein | amidohydrolase family protein | alcohol dehydrogenase, iron-containing | glycosyl transferase, group 1/2 family protein | cobyrinic acid a,c-diamide synthase | glucose-6-phosphate isomerase | sugar fermentation stimulation protein | peptidase/PDZ domain protein | hemolysin III |
84 | 19 | 366 | -26.309 | 0.529 | Residual = 0.529 | | GgcTGCGcTgCGCCA | CGCAAGGCtG | | DVU0643 DVU0823 DVU0904 DVU0972 DVU1099 DVU1255 DVU1356 DVU1694 DVU1743 DVU1749 DVU1981 DVU2237 DVU2242 DVU2559 DVU2678 DVU2831 DVU2915 DVU3189 DVU3378 | argJ recJ bioA | thiF protein, putative | bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein | single-stranded-DNA-specific exonuclease RecJ | HD domain protein | tail fiber assembly protein, putative | Sua5/YciO/YrdC/YwlC family protein | C4-type zinc finger protein, DksA/TraR family | hypothetical protein | nucleotide-binding protein | cobalamin biosynthesis protein CobD, putative | asparaginase family protein | adenosylmethionine--8-amino-7-oxononanoate aminotransferase | RNA pseudouridine synthase family protein | NOL1/NOP2/sun family protein | YbaK/EbsC protein |
85 | 14 | 369 | -47.271 | 0.445 | Residual = 0.445 | | CAnCAcCCTCgACCnngGngA | GACAcACAcCACcaG | | DVU0430 DVU0497 DVU0610 DVU1080 DVU1870 DVU1979 DVU1982 DVU2116 DVU2136 DVU2196 DVU2768 DVU3078 DVU3362 DVUA0087 | rhlE | Ech hydrogenase, subunit EchE, putative | hypothetical protein | iron-sulfur cluster-binding protein | cyclase, putative | ABC transporter, ATP-binding protein | ATP-dependent RNA helicase RhlE | pilin, putative | comF family protein | sensory box histidine kinase |
86 | 20 | 370 | -29.907 | 0.510 | Residual = 0.510 | | TgCgGgAA | CaTGAcAAGAGnCgA | | DVU0028 DVU0383 DVU0628 DVU1403 DVU1404 DVU1598 DVU1654 DVU1736 DVU1941 DVU1955 DVU1979 DVU2136 DVU2224 DVU2228 DVU2250 DVU2502 DVU2510 DVU2640 DVU3362 DVUA0087 | csaA buk cobO murB | chaperone CsaA | hypothetical protein | butyrate kinase | cob(I)alamin adenosyltransferase | radical SAM domain protein | site-specific recombinase, phage integrase family | HAD-superfamily hydrolase, subfamily IIA | TPR domain protein | ABC transporter, ATP-binding protein | motB protein, putative | AMP-binding protein | UDP-N-acetylenolpyruvoylglucosamine reductase | penicillin-binding protein | sensory box histidine kinase |
87 | 29 | 364 | -27.237 | 0.545 | Residual = 0.545 | | GGgcTtCnGCaaCg | TtTcgCgGTGcTgCGgTGcGCT | | DVU0077 DVU0258 DVU0295 DVU0661 DVU0731 DVU0740 DVU0742 DVU0743 DVU1187 DVU1357 DVU1371 DVU1391 DVU1435 DVU1439 DVU1465 DVU1869 DVU2885 DVU2993 DVU2996 DVU2997 DVU2998 DVU3008 DVU3015 DVU3017 DVU3126 DVU3180 DVU3196 DVU3215 DVU3224 | sfsA | hypothetical protein | sensory box histidine kinase/response regulator | amine oxidase, flavin-containing | dihydrouridine synthase family protein | sensory box histidine kinase | HAD-superfamily hydrolase, subfamily IA | CgeB family protein | methyl-accepting chemotaxis protein | alcohol dehydrogenase, iron-containing | glycosyl transferase, group 1/2 family protein | NAD-dependent epimerase/dehydratase family protein | NeuB family protein | GGDEF domain protein | twin-arginine translocation pathway signal sequence domain protein | response regulator | sugar fermentation stimulation protein |
88 | 15 | 366 | -51.499 | 0.394 | Residual = 0.394 | | TTcTTTAATTAAA | gAAcAGCc | | DVU0106 DVU0321 DVU0945 DVU1027 DVU1406 DVU1652 DVU1778 DVU1831 DVU2372 DVU2607 DVU2608 DVU2650 DVU3085 DVU3088 DVU3149 | glnP purM motA-3 sppA | glutamine ABC transporter, permease protein | pantothenate kinase | sensor histidine kinase | hypothetical protein | phosphoribosylaminoimidazole synthetase | HIT family protein | cation efflux family protein | flagellar motor protein MotA | ATP-dependent RNA helicase, DEAD/DEAH box family | signal peptide peptidase SppA, 36K type |
89 | 6 | 355 | -15.831 | 0.571 | Residual = 0.571 | | AAAAAGG | AAATAGA | | DVU0332 DVU0733 DVU0799 DVU0932 DVU2790 DVU3092 | | hypothetical protein | sensor histidine kinase |
90 | 22 | 373 | -50.359 | 0.447 | Residual = 0.447 | | gtAtaaCActgnATcAagaAAnnA | CAaTaGatgacnAtgaaaTtc | | DVU0223 DVU0526 DVU0727 DVU0728 DVU0756 DVU1151 DVU1379 DVU1492 DVU1628 DVU1629 DVU1630 DVU1710 DVU1729 DVU1730 DVU1855 DVU2001 DVU2309 DVU2423 DVU2614 DVU2845 DVU2846 DVUA0089 | rpoN yfiA | hypothetical protein | drug resistance transporter, putative | TPR domain protein | RNA polymerase sigma-54 factor | ribosomal subunit interface protein | PTS system, IIA component | killer protein, putative | DNA-binding protein | integrase, truncation | methyl-accepting chemotaxis protein, putative | transcriptional regulator, putative | HIT family protein |
91 | 1 | 365 | -140.870 | 1.000 | Residual = 1.000 | |
|
| | DVU0385 | | hypothetical protein |
92 | 29 | 370 | -32.551 | 0.540 | Residual = 0.540 | | TGCaTctGcTtTCcTGTtgGA | AAGCGCACACAGTGCCACATGGCA | | DVU0017 DVU0605 DVU0696 DVU0705 DVU0706 DVU0707 DVU0708 DVU0709 DVU0909 DVU0914 DVU1229 DVU1235 DVU1388 DVU1591 DVU1747 DVU1759 DVU1994 DVU2002 DVU2101 DVU2102 DVU2103 DVU2199 DVU2219 DVU2301 DVU2319 DVU2911 DVU3120 DVU3131 DVU3340 | dctM dctP cobS | hypothetical protein | TRAP transporter, DctM subunit | TRAP transporter, DctQ subunit | TRAP transporter solute receptor DctP | cobalamin-5-phosphate synthase | ATPase, histidine kinase-, DNA gyrase B-, and HSP90-like domain protein | molybdenum-binding protein, HTH domain | outer membrane protein, OMP85 family | iron-sulfur cluster-binding/ATPase domain protein | lipoprotein, putative | transcriptional regulator domain protein | hemolysin A | transcriptional regulator, putative |
93 | 1 | 350 | -139.542 | 1.000 | Residual = 1.000 | |
|
| | DVU0037 | | hypothetical protein |
94 | 24 | 372 | -34.094 | 0.534 | Residual = 0.534 | | ATCGCTggTttGcatGTtaaT | CaTcAACCGgagAcaAGGAACaaC | | DVU0060 DVU0061 DVU0062 DVU0063 DVU0224 DVU0603 DVU1201 DVU1332 DVU1775 DVU1791 DVU1862 DVU1892 DVU2130 DVU2256 DVU2279 DVU2280 DVU2298 DVU2738 DVU2771 DVU3151 DVU3194 DVU3204 DVU3205 DVU3327 | ribD selD ribB ruvA engA purA | efflux transporter, RND family, MFP subunit | multidrug resistance protein, putative | RND efflux system, outer membrane protein, NodT family | transcriptional regulator, MarR family | hypothetical protein | riboflavin biosynthesis protein RibD | selenide, water dikinase, selenocysteine-containing | 3,4-dihydroxy-2-butanone 4-phosphate synthase | GatB/Yqey family protein | GGDEF domain protein | glycosyl transferase, group 2 family protein | Holliday junction DNA helicase RuvA | amino acid permease family protein | glycine/betaine/L-proline ABC transporter, permease protein | methyl-accepting chemotaxis protein | MiaB-like tRNA modifying enzyme YliG, TIGR01125 | GTP-binding protein EngA | adenylosuccinate synthetase | transglycosylase SLT domain protein | multidrug resistance protein, Smr family |
95 | 13 | 364 | -22.773 | 0.582 | Residual = 0.582 | | TTTTTCA | tgCcGcCcTgccGaCA | | DVU0075 DVU0085 DVU0116 DVU0143 DVU0144 DVU1134 DVU1281 DVU1765 DVU1767 DVU1768 DVU1799 DVU1882 DVU3012 | trpB-1 hupB thiH fusA-2 | aminotransferase, DegT/DnrJ/EryC1/StrS family | tryptophan synthase subunit beta | polysaccharide deacetylase family protein | hypothetical protein | cytidyltransferase-related domain protein | DNA-binding protein HU, beta subunit | thiamine biosynthesis protein ThiH | biotin synthase | GTP-binding protein | elongation factor G | HDIG domain protein |
96 | 7 | 361 | -21.708 | 0.599 | Residual = 0.599 | | CaTCtgCCcTgCatcAaaG | AAAggTTTACA | | DVU0251 DVU1168 DVU1254 DVU2412 DVU2577 DVU3098 DVU3363 | sun | hypothetical protein | sensory box histidine kinase | DNA-binding response regulator, LuxR family | sun protein |
97 | 22 | 368 | -42.842 | 0.546 | Residual = 0.546 | | AaCGAcgTgCtCCgCnCAaaAGA | GACAaagtGCAaCAtCntaacAac | | DVU0078 DVU0139 DVU0622 DVU1083 DVU1156 DVU1224 DVU1726 DVU2269 DVU2270 DVU2271 DVU2272 DVU2665 DVU2736 DVU2750 DVU2751 DVU2752 DVU2753 DVU2939 DVU3170 DVUA0004 DVUA0066 DVUA0093 | phoB nfo cbiD cobJ | hypothetical protein | sensor histidine kinase | sensor histidine kinase/response regulator | phosphate regulon transcriptional regulator PhoB | sigma-54 dependent transcriptional regulator, putative/response regulator | endonuclease IV | pyruvate formate-lyase activating enzyme, putative | formate acetyltransferase, putative | phosphate ABC transporter, permease protein, putative | cobalamin biosynthesis protein CbiD | rhodanese-like domain protein | C_GCAxxG_C_C family protein | precorrin-3b C17-methyltransferase | DNA-binding protein HU, putative | phospholipase, patatin family | chromate transport family protein |
98 | 15 | 367 | -58.914 | 0.389 | Residual = 0.389 | | GAAAAA | ActgccaAcGAtGcCAggCC | | DVU0280 DVU0281 DVU0669 DVU0817 DVU0954 DVU1688 DVU1690 DVU1793 DVU1796 DVU1798 DVU1809 DVU1931 DVU2373 DVU2569 DVUA0074 | nadB | glycosyl transferase, group 1 family protein | exopolysaccharide biosynthesis protein, putative | hypothetical protein | organic solvent tolerance protein, putative | 1-acyl-sn-glycerol-3-phosphate acyltransferase, putative | transcriptional regulator, TetR family | L-aspartate oxidase | iron-sulfur cluster-binding protein | outer membrane protein, OMP85 family | peptidyl-prolyl cis-trans isomerase, FKBP-type | sulfotransferase family protein |
99 | 27 | 360 | -32.455 | 0.530 | Residual = 0.530 | | aagTntTcACaGctTCTgcCGATA | ATtgTgAtACtTtaCccATTG | | DVU0020 DVU0140 DVU0148 DVU0149 DVU0150 DVU0151 DVU0152 DVU0231 DVU0232 DVU0358 DVU0360 DVU0361 DVU0391 DVU0394 DVU0644 DVU0672 DVU0976 DVU0977 DVU0989 DVU1072 DVU1073 DVU1259 DVU1824 DVU2095 DVU2100 DVU2666 DVU3073 | ilvB-1 thiS | hypothetical protein | response regulator | lipoprotein, putative | HAMP domain/sigma-54 interaction domain protein | phosphoenolpyruvate synthase-related protein | acetolactate synthase catalytic subunit | acetolactate synthase 1 regulatory subunit | radical SAM domain protein | periplasmic divalent cation tolerance protein cutA, putative | thiamine biosynthesis protein ThiS | universal stress protein family | phosphate ABC transporter, permease protein, putative |
100 | 20 | 368 | -46.392 | 0.429 | Residual = 0.429 | | TGAanAggATT | TgTctAaGAnnnTGTTTtnCa | | DVU0543 DVU1161 DVU1476 DVU1482 DVU1517 DVU1518 DVU1738 DVU1779 DVU1872 DVU1972 DVU1998 DVU2008 DVU2074 DVU2134 DVU2189 DVU2190 DVU2213 DVU2632 DVU2685 DVU3314 | | hypothetical protein | transcriptional regulator cII, putative | transcriptional regulator cI, truncation | site-specific recombinase, phage integrase family | chemotaxis protein CheW | transcriptional regulator, putative | nuclease domain protein | peptidase, U32 family |
101 | 11 | 369 | -86.570 | 0.328 | Residual = 0.328 | | CTcTCCgAG | gAAGAC | | DVU1106 DVU1115 DVU1123 DVU1124 DVU1125 DVU1130 DVU1132 DVU1133 DVU1137 DVU1138 DVU1140 | | hypothetical protein | DNA-binding protein | bacteriophage transposase A protein, putative |
102 | 15 | 373 | -74.418 | 0.352 | Residual = 0.352 | | GCGcATGGCAtgAA | AgGttGTTTTC | | DVU0610 DVU0675 DVU1052 DVU1059 DVU1234 DVU1735 DVU1757 DVU1815 DVU2072 DVU2077 DVU2084 DVU2094 DVU2599 DVU2781 DVU3152 | cheA-3 thiG | hypothetical protein | amino acid ABC transporter, periplasmic amino acid-binding protein | CBS domain protein | aminotransferase, putative | site-specific recombinase, phage integrase family | cytochrome c oxidase, subunit I, putative | chemotaxis protein CheA | oligopeptide-binding protein, putative | thiazole synthase | sensory box histidine kinase |
103 | 15 | 357 | -42.030 | 0.524 | Residual = 0.524 | | gTGCcnCacCAcgatacGAC | GCgCAGCCTcACaCcACA | | DVU0036 DVU0344 DVU0567 DVU0637 DVU0645 DVU2211 DVU2971 DVU2979 DVU2981 DVU2982 DVU2983 DVU2984 DVU2985 DVU3383 DVU3385 | leuA leuD leuB | hypothetical protein | methyl-accepting chemotaxis protein | TerC family protein | glycosyl transferase, family 8 | phosphatidylserine decarboxylase | 2-isopropylmalate synthase | 3-isopropylmalate dehydratase, large subunit | 3-isopropylmalate dehydratase, small subunit | 3-isopropylmalate dehydrogenase |
104 | 12 | 371 | -83.111 | 0.334 | Residual = 0.334 | | TgCCAtcgaCAAGGAGaa | TTGATGcCGTCA | | DVU0241 DVU0811 DVU1430 DVU1468 DVU1976 DVU1977 DVU2078 DVU2079 DVU2310 DVU2441 DVU2442 DVU2643 | dnaK groEL groES cheB-2 htpG | hypothetical protein | dnaK protein | peptidase, M16 family | peptidase/PDZ domain protein | chaperonin GroEL | chaperonin, 10 kDa | protein-glutamate methylesterase CheB | sensory box histidine kinase | metallo-beta-lactamase family protein | heat shock protein, Hsp20 family | heat shock protein 90 |
105 | 32 | 365 | -27.265 | 0.553 | Residual = 0.553 | | tgGtCGacatcCCCCTcCGgttCt | GCCgcAancgCCTtCntcA | | DVU0118 DVU0254 DVU0289 DVU0294 DVU0482 DVU0581 DVU0582 DVU0584 DVU0608 DVU0634 DVU0640 DVU0755 DVU0992 DVU1030 DVU1359 DVU1404 DVU1535 DVU1853 DVU2138 DVU2141 DVU2195 DVU2312 DVU2410 DVU2429 DVU2472 DVU2556 DVU2668 DVU2707 DVU2708 DVU3062 DVU3268 DVU3388 | moaC pomA cheV-3 sodB | sigma-54 dependent transcriptional regulator/response regulator | hypothetical protein | molybdenum cofactor biosynthesis protein C | glycosyl transferase, group 2 family protein | sensory box histidine kinase/response regulator | response regulator/anti-anti-sigma factor | sensory box histidine kinase | transposase, putative | methyl-accepting chemotaxis protein | chemotaxis protein PomA | sensor histidine kinase, putative | chemotaxis protein CheV | universal stress protein family | radical SAM domain protein | nucleic acid-binding protein, putative | superoxide dismutase, Fe | UDP-N-acetylglucosamine pyrophosphorylase, putative | virion morphogenesis protein | sensor histidine kinase/response regulator | lipoprotein, putative |
106 | 20 | 368 | -26.702 | 0.588 | Residual = 0.588 | | CATCAtCGtcATCgT | TgTCtCnTCcAGgnCggnAAGcCg | | DVU0188 DVU0231 DVU0329 DVU0368 DVU0452 DVU0498 DVU0747 DVU0750 DVU1153 DVU2137 DVU2193 DVU2591 DVU2592 DVU2668 DVU2872 DVU2873 DVU2887 DVU3289 DVU3334 DVU3390 | sucCD | hypothetical protein | iron-sulfur cluster-binding protein, putative | ABC transporter, ATP-binding protein | methyl-accepting chemotaxis protein | succinyl-CoA synthase, beta/alpha subunits | tail fiber assembly protein, putative | UDP-N-acetylglucosamine pyrophosphorylase, putative | phage portal protein, lambda family | sigma-54 dependent DNA-binding response regulator |
107 | 8 | 359 | -15.029 | 0.609 | Residual = 0.609 | | AAAAAAA | AcGGaAAG | | DVU0068 DVU0288 DVU0667 DVU0999 DVU2181 DVU2734 DVU2873 DVU2950 | | hypothetical protein | HD domain protein | thio:disulfide interchange protein, putative | antirepressor, putative |
108 | 1 | 345 | -140.937 | 1.000 | Residual = 1.000 | |
|
| | DVU2193 | | hypothetical protein |
109 | 31 | 365 | -25.442 | 0.562 | Residual = 0.562 | | CaCgGGGcaACAgGcCAtGCa | cGGCntgnTGC | | DVU0053 DVU0125 DVU0137 DVU0164 DVU0423 DVU0424 DVU0586 DVU0611 DVU0631 DVU0770 DVU0981 DVU1088 DVU1358 DVU1420 DVU1436 DVU1657 DVU1920 DVU1924 DVU1925 DVU1926 DVU2297 DVU2411 DVU2414 DVU2429 DVU2450 DVU2775 DVU2918 DVU2936 DVU3137 DVU3217 DVU3282 | cls hypC fabG | sulfate permease, putative | hypothetical protein | cation efflux family protein | universal stress protein family | cardiolipin synthetase | ABC transporter, ATP-binding protein | multiphosphoryl transfer protein, putative | hydrolase, haloacid dehalogenase-like family | Hpt domain protein | hydrogenase assembly chaperone hypC/hupF | lipase, GDSL family | glycine/betaine/L-proline ABC transporter, periplasmic-binding protein | EF hand domain protein | 3-ketoacyl-(acyl-carrier-protein) reductase | ADP-ribosylglycohydrolase family protein |
110 | 25 | 364 | -40.988 | 0.476 | Residual = 0.476 | | GatGTCTTTTtTgctAattnA | gCAttatatgacnAtGatCatc | | DVU0298 DVU0421 DVU0727 DVU0728 DVU0756 DVU0801 DVU0866 DVU0955 DVU0985 DVU1013 DVU1151 DVU1554 DVU1628 DVU1644 DVU1645 DVU2282 DVU2309 DVU2362 DVU2439 DVU2548 DVU2662 DVU3079 DVU3135 DVU3136 DVU3316 | uvrC dxr alr rpoN thiE acpD pyrD | hypothetical protein | agmatinase, putative | TPR domain protein | excinuclease ABC, C subunit | 1-deoxy-D-xylulose 5-phosphate reductoisomerase | alanine racemase | type I secretion outer membrane protein, TolC family | radical SAM domain protein | RNA polymerase sigma-54 factor | permease, putative | transcriptional regulator, ArsR family | methyl-accepting chemotaxis protein, putative | thiamine-phosphate pyrophosphorylase | efflux transporter, RND family, MFP subunit | acyl carrier protein phosphodiesterase | glyoxalase family protein | flavodoxin-like fold domain protein | nitroreductase family protein | dihydroorotate dehydrogenase |
111 | 16 | 372 | -62.575 | 0.395 | Residual = 0.395 | | tCantctTcTTTTca | AgAaAaAT | | DVU1519 DVU1520 DVU1521 DVU2000 DVU2006 DVU2007 DVU2105 DVU2106 DVU2174 DVU2177 DVU2709 DVU2837 DVU2838 DVU2840 DVUA0019 DVUA0020 | | transcriptional regulator, putative | hypothetical protein | nuclease, putative | sigma-54 dependent transcriptional regulator | type II DNA modification methyltransferase, putative | type II restriction endonuclease, putative |
112 | 31 | 357 | -26.124 | 0.529 | Residual = 0.529 | | ACTTCACgAC | GCCcGaAcgGttGacGtGTTCGcC | | DVU0032 DVU0118 DVU0119 DVU0120 DVU0289 DVU0482 DVU0581 DVU0582 DVU0631 DVU0634 DVU0814 DVU1136 DVU1219 DVU1338 DVU1419 DVU1547 DVU1549 DVU2337 DVU2352 DVU2472 DVU2588 DVU2732 DVU2739 DVU2896 DVU2994 DVU3010 DVU3012 DVU3153 DVU3209 DVU3336 DVU3388 | moaC | hypothetical protein | sigma-54 dependent transcriptional regulator/response regulator | sensor histidine kinase | ABC transporter, substrate-binding protein, putative | molybdenum cofactor biosynthesis protein C | sensory box histidine kinase/response regulator | response regulator/anti-anti-sigma factor | sensory box histidine kinase | bacterioferritin comigratory protein, putative | host-nuclease inhibitor protein Gam, putative | sensory box protein | peptidase, M23/M37 family | glycosyl transferase, group 2 family protein | DNA-binding response regulator | pyruvate phosphate dikinase, PEP/pyruvate binding domain protein | TPR domain protein | aminotransferase, DegT/DnrJ/EryC1/StrS family | potassium channel histidine kinase domain protein/universal stress protein | lipoprotein, putative |
113 | 21 | 365 | -29.561 | 0.517 | Residual = 0.517 | | TTTGcCaTaT | aTAtCGTAgCCGCGggCCTTGC | | DVU0113 DVU0114 DVU0387 DVU0794 DVU0796 DVU0885 DVU1042 DVU1764 DVU1863 DVU1950 DVU1952 DVU2051 DVU2054 DVU2275 DVU2522 DVU2552 DVU2910 DVU2916 DVU2917 DVU3367 DVU3368 | hisI hisG fabI hisD tatB gltX-2 hemK lpxC aspS hisS | phosphoribosyl-AMP cyclohydrolase | ATP phosphoribosyltransferase | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | enoyl-(acyl-carrier-protein) reductase | histidinol dehydrogenase | amidohydrolase family protein | twin-arginine translocation protein TatB | hypothetical protein | flagellar synthesis regulator FleN, putative | indolepyruvate ferredoxin oxidoreductase, beta subunit, putative | sigma-54 dependent transcriptional regulator | glutamyl-tRNA synthetase | hemK protein | UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase | aspartyl-tRNA synthetase | histidyl-tRNA synthetase |
114 | 11 | 371 | -87.401 | 0.319 | Residual = 0.319 | | CaccAACAAGGAG | TGTGCGTGG | | DVU0241 DVU0242 DVU0420 DVU1337 DVU1430 DVU2441 DVU2442 DVU2494 DVU2495 DVU2977 DVU2978 | lon | hypothetical protein | SEC-C motif domain protein | ATP-dependent protease La | peptidase, M16 family | heat shock protein, Hsp20 family | peptidase, M48 family | thioesterase family protein | hydrolase, haloacid dehalogenase-like family |
115 | 26 | 362 | -30.970 | 0.508 | Residual = 0.508 | | CacnngAtACggcaAGGAgAa | cCGCCGtCagCCCcgtcctgaG | | DVU0046 DVU0290 DVU0573 DVU0741 DVU0744 DVU0881 DVU0984 DVU1012 DVU1359 DVU1422 DVU1438 DVU1472 DVU1541 DVU1980 DVU2141 DVU2313 DVU2360 DVU2446 DVU2556 DVU2630 DVU2894 DVU2895 DVU3153 DVU3220 DVU3221 DVUA0031 | fliN creA miaB pgl panB | flagellar motor switch protein FliN | lipoprotein, putative | creA protein | hypothetical protein | sigma-54 dependent transcriptional regulator/response regulator | elongation factor G | tRNA-i(6)A37 modification enzyme MiaB | hemolysin-type calcium-binding repeat protein | OmpA family protein | cobyrinic acid a,c-diamide synthase family protein | ATP-dependent protease, putative | nucleic acid-binding protein, putative | 6-phosphogluconolactonase | oxidoreductase, FAD/NAD-binding family | 3-methyl-2-oxobutanoate hydroxymethyltransferase | sigma-54 dependent transcriptional regulator | sensor histidine kinase |
116 | 8 | 361 | -20.582 | 0.588 | Residual = 0.588 | | AGAGAGTCTTC | tGtctCgCCTT | | DVU0364 DVU0567 DVU0708 DVU1591 DVU2305 DVU2492 DVU2617 DVU3252 | pabA trpF-2 | para-aminobenzoate/anthranilate synthase glutamine amidotransferase | TerC family protein | hypothetical protein | N-(5'-phosphoribosyl)anthranilate isomerase | sodium/calcium exchanger family protein |
117 | 26 | 372 | -36.621 | 0.491 | Residual = 0.491 | | CtTgTCAtCGCTGTA | CGATGCGctGcCGcaaCggCt | | DVU0007 DVU0110 DVU0156 DVU0326 DVU0413 DVU0612 DVU0760 DVU1376 DVU1461 DVU1462 DVU1463 DVU1464 DVU1544 DVU1883 DVU2140 DVU2329 DVU2338 DVU2491 DVU2765 DVU2766 DVU2767 DVU2932 DVU3009 DVU3067 DVU3172 DVU3216 | asnC hypE ilvB-2 hemA tmk hypB hypF | asparaginyl-tRNA synthetase | sigma-54 dependent transcriptional regulator/response regulator | ATP-dependent DNA helicase, UvrD/REP family | hydrogenase expression/formation protein HypE | potassium uptake protein, TrkH family | STAS domain protein | hypothetical protein | acetolactate synthase, large subunit, biosynthetic type | glutamyl-tRNA reductase | cytochrome c assembly protein, putative | siroheme synthase, N-terminal domain protein | heptosyltransferase family protein | mechanosensitive ion channel family protein | thymidylate kinase | hydrogenase accessory protein HypB | DNA repair protein, HhH-GPD family | ABC transporter, ATP-binding protein | metallo-beta-lactamase family protein | iron-sulfur flavoprotein, putative | conserved hypothetical protein TIGR01777 | radical SAM domain protein | [NiFe] hydrogenase maturation protein HypF | sensor histidine kinase |
118 | 16 | 367 | -35.155 | 0.452 | Residual = 0.452 | | CGTTGC | ATGAAA | | DVU0609 DVU1098 DVU1110 DVU1356 DVU1598 DVU1702 DVU1703 DVU1753 DVU1755 DVU1871 DVU2132 DVU2133 DVU2196 DVU2207 DVU2270 DVU2808 | aspA | lipoprotein, putative | adenine specific DNA methyltransferase, putative | hypothetical protein | HD domain protein | type I restriction-modification enzyme, R subunit | aspartate ammonia-lyase | TonB domain protein |
119 | 25 | 362 | -33.922 | 0.488 | Residual = 0.488 | | CTgCTTGcaCggtAngGctCGC | ATCATACATAcAA | | DVU0093 DVU0146 DVU0159 DVU0160 DVU0243 DVU0319 DVU0359 DVU0380 DVU0417 DVU0418 DVU0831 DVU1192 DVU1467 DVU1722 DVU2258 DVU2420 DVU2486 DVU2554 DVU2555 DVU2641 DVU2658 DVU2659 DVU2667 DVU2752 DVU2876 | speA lys1 hslU ruvC | conserved domain protein/glycosyl transferase, group 1 family protein | hypothetical protein | thioesterase family protein | carbohydrate isomerase, KpsF/GutQ family | lipoprotein, putative | NAD-dependent epimerase/dehydratase family protein | HesB-like domain | sulfatase, putative | arginine decarboxylase | saccharopine dehydrogenase | PTS system, IID component, putative | acylphosphatase | ATP-dependent protease ATP-binding subunit | crossover junction endodeoxyribonuclease RuvC | acetyltransferase, GNAT family | MATE efflux family protein | exsB protein | phosphate ABC transporter, periplasmic phosphate-binding protein, putative | rhodanese-like domain protein | terminase, large subunit, putative |
120 | 15 | 364 | -36.377 | 0.487 | Residual = 0.487 | | GGtTGACaacg | AGgGGGgAGactCG | | DVU0298 DVU0370 DVU0421 DVU0526 DVU0590 DVU0662 DVU0664 DVU0758 DVU1212 DVU1213 DVU1278 DVU1336 DVU2555 DVU3345 DVU3346 | cysE fsxA ftsH clpX | hypothetical protein | agmatinase, putative | drug resistance transporter, putative | serine O-acetyltransferase | cysteine desulfurase | fxsA protein | rhomboid family protein | cell division protein FtsH | ATP-dependent protease ATP-binding subunit | MATE efflux family protein |
121 | 26 | 368 | -33.052 | 0.495 | Residual = 0.495 | | gAtAtTCAaGAAagangatT | ttCaaTTGAantGanAanTG | | DVU0196 DVU0408 DVU0563 DVU0802 DVU0993 DVU1171 DVU1367 DVU1387 DVU1739 DVU1750 DVU1773 DVU1995 DVU2017 DVU2068 DVU2178 DVU2263 DVU2671 DVU2682 DVU2842 DVU3038 DVU3138 DVU3218 DVUA0018 DVUA0067 DVUA0071 DVUA0135 | pncA | hypothetical protein | response regulator/sensory box/GGDEF domain/EAL domain protein | ISD1, transposase OrfB | twin-arginine translocation protein, TatA/E family | anti-anti-sigma factor | ISDvu5, transposase | HD domain protein | ISDvu2, transposase OrfB | outer membrane autotransporter barrel domain protein | HDIG/HD/KH domain protein | DedA family protein | type II DNA modification methyltransferase, putative | pyrazinamidase/nicotinamidase | glycosyl transferase, group 1/2 family protein | CRISPR-associated protein Cas2 |
122 | 26 | 366 | -35.792 | 0.490 | Residual = 0.490 | | AAGTnctntCggcgtCtgCCGATA | aAtagGtGAaGcTtcaCnaTt | | DVU0033 DVU0122 DVU0123 DVU0523 DVU0524 DVU0583 DVU0598 DVU0599 DVU0935 DVU0942 DVU0976 DVU0977 DVU1073 DVU1241 DVU1786 DVU1854 DVU1857 DVU1869 DVU1880 DVU2444 DVU2445 DVU2516 DVU2948 DVU2952 DVU3125 DVU3218 | flgM pncA | isochorismatase family protein | hypothetical protein | negative regulator of flagellin synthesis FlgM | lipoprotein, putative | carbon starvation protein A, putative | methyl-accepting chemotaxis protein | transcriptional regulator, Fur family | response regulator | GGDEF domain protein | flagellin | CBS domain protein | bacterial flagellin N-terminal domain protein | pyrazinamidase/nicotinamidase |
123 | 26 | 362 | -23.215 | 0.539 | Residual = 0.539 | | AAgCCCCgGCAACAC | agACGaCATGn | | DVU0050 DVU0884 DVU0960 DVU0970 DVU0984 DVU1243 DVU1358 DVU1384 DVU1419 DVU1436 DVU1593 DVU1597 DVU1603 DVU1846 DVU2312 DVU2428 DVU2474 DVU2990 DVU3137 DVU3140 DVU3230 DVU3231 DVU3254 DVU3266 DVU3342 DVU3393 | motA-1 miaB pyrR cheY-1 aat pgsA moeA fabG | chemotaxis protein MotA | hypothetical protein | lipoprotein, putative | tRNA-i(6)A37 modification enzyme MiaB | hydrolase, haloacid dehalogenase-like family | pyrimidine regulatory protein PyrR | sigma-54 dependent transcriptional regulator/response regulator | chemotaxis protein CheY | sulfite reductase, assimilatory-type | leucyl/phenylalanyl-tRNA--protein transferase | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase | molybdopterin biosynthesis MoeA protein | 3-ketoacyl-(acyl-carrier-protein) reductase | capsular polysaccharide transport protein, putative | flagellar synthesis regulator FleN | flagellar biosynthesis protein FlhF, putative | PDZ domain protein |
124 | 14 | 372 | -59.867 | 0.412 | Residual = 0.412 | | CgACAGGagAc | CGGCCCtTCcC | | DVU0430 DVU0658 DVU0894 DVU1052 DVU1208 DVU1766 DVU2139 DVU2601 DVU2640 DVU2758 DVU2777 DVU3169 DVU3257 DVUA0148 | aroC plsX cbiG | Ech hydrogenase, subunit EchE, putative | heat shock protein, Hsp20 family | chorismate synthase | CBS domain protein | fatty acid/phospholipid synthesis protein | aspartate ammonia-lyase | histone deacetylase family protein | hypothetical protein | cobalamin biosynthesis protein CbiG | DNA internalization-related competence protein ComEC/Rec2 | major facilitator superfamily protein |
125 | 19 | 376 | -73.870 | 0.408 | Residual = 0.408 | | CTGCCGGcAtCcTGtCCGCATCA | TCngCACcnTGcaatcGaAAGGg | | DVU0310 DVU0311 DVU0312 DVU0313 DVU0314 DVU0315 DVU0512 DVU0513 DVU0515 DVU0516 DVU0517 DVU0519 DVU0913 DVU2232 DVU3003 DVU3004 DVU3018 DVU3019 DVU3020 | fliI fliG fliF fliE flgC flgG flgH flgI | flagellum-specific ATP synthase FliI | flagellar assembly protein FliH, putative | flagellar motor switch protein FliG | flagellar M-ring protein FliF | flagellar basal body component FliE | flagellar basal-body rod protein FlgC | flagellar basal-body rod protein, putative | flagellar basal body rod protein FlgG | flagellar basal body L-ring protein | flagellar basal body P-ring protein | peptidase, M23/M37 family | flagellar hook-associated protein FlgK, putative | hypothetical protein | radical SAM domain protein | radical SAM/B12 binding domain protein |
126 | 29 | 369 | -28.636 | 0.508 | Residual = 0.508 | | AAAcaGgtgAaAAAt | cAgCGtgAagA | | DVU0405 DVU0546 DVU0548 DVU0549 DVU0550 DVU0585 DVU0653 DVU0695 DVU0731 DVU0746 DVU0781 DVU0782 DVU0844 DVU0998 DVU1081 DVU1084 DVU1171 DVU1184 DVU1369 DVU1371 DVU1393 DVU1776 DVU1848 DVU2316 DVU2478 DVU2568 DVU2584 DVU3072 DVU3239 | cobB-1 pstB-1 topB pstC | cobyrinic acid a,c-diamide synthase | hypothetical protein | high-affinity branched-chain amino acid ABC transporter, permease protein | high-affinity branched-chain amino acid ABC transporter, ATP binding protein | sigma-54 dependent transcriptional regulator, putative/response regulator | ABC transporter, permease protein | heptosyltransferase family protein | iron-sulfur cluster-binding protein | phosphate ABC transporter, ATP-binding protein | HAD-superfamily hydrolase, subfamily IA | DNA topoisomerase III | phosphate ABC transporter, permease protein PstC | peptidase, M20/M25/M40 family | transporter, CorA family | ABC transporter, permease protein, putative | PAP2 family protein |
127 | 10 | 362 | -24.548 | 0.509 | Residual = 0.509 | | CATGACcG | aTACATcaTTT | | DVU0406 DVU0852 DVU1097 DVU1689 DVU1786 DVU1787 DVU1895 DVU3120 DVU3121 DVU3383 | | hypothetical protein | extracellular solute-binding protein, putative | GGDEF domain protein | nuclease domain protein | major facilitator superfamily protein | aminotransferase, class V |
128 | 25 | 370 | -50.470 | 0.542 | Residual = 0.542 | | gCcAtTtgTntngacTTGTcaCga | GAACgGAACCCcaAGGCAGTaTAC | | DVU0732 DVU0891 DVU1355 DVU1647 DVU1648 DVU1649 DVU1651 DVU1652 DVU1655 DVU1865 DVU1886 DVU1887 DVU1888 DVU1889 DVU2499 DVU2500 DVU2501 DVU2503 DVU2504 DVU2505 DVU2506 DVU2507 DVU2511 DVU2512 DVU2513 | valS lysA-1 mutS gmhA ftsZ ftsA murC murG murD mraY mraW mraZ | valyl-tRNA synthetase | aminotransferase, classes I and II | hypothetical protein | diaminopimelate decarboxylase | lipoprotein, putative | DNA mismatch repair protein | HIT family protein | aspartate aminotransferase | ATP-NAD kinase domain protein | phosphoheptose isomerase | cell division protein FtsZ | cell division protein FtsA | cell division protein FtsQ, putative | UDP-N-acetylmuramate--alanine ligase | UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | cell cycle protein, FtsW/RodA/SpoVE family | UDP-N-acetylmuramoylalanine--D-glutamate ligase | phospho-N-acetylmuramoyl-pentapeptide- transferase | S-adenosyl-methyltransferase MraW |
129 | 14 | 371 | -75.705 | 0.396 | Residual = 0.396 | | GttTcgaTgAATattGAGCgT | AAGGCgGG | | DVU1493 DVU1496 DVU1498 DVU1499 DVU1500 DVU1502 DVU1513 DVU1514 DVU1515 DVU1516 DVU1517 DVU1522 DVU1524 DVU1525 | | hypothetical protein | major capsid protein, HK97 family | portal protein, HK97 family | type II DNA modification methyltransferase, putative | transcriptional regulator cII, putative |
130 | 12 | 374 | -68.316 | 0.379 | Residual = 0.379 | | GATGTCAcCGAGGA | CAcGtAtCAtc | | DVU0365 DVU0375 DVU0497 DVU0887 DVU1068 DVU1490 DVU1829 DVU2159 DVU2161 DVU2266 DVU3129 DVUA0009 | | hypothetical protein | Glu/Leu/Phe/Val dehydrogenase family protein | transglycosylase, putative | branched-chain amino acid ABC transporter, permease protein | tail tape measure protein, putative | nitrogenase MoFe cofactor biosynthesis protein NifE domain protein |
131 | 26 | 375 | -34.272 | 0.541 | Residual = 0.541 | | GCAcAGtgTGCgcaCGTATCACAC | CGCngcGnGCctaGTCGCGcC | | DVUA0027 DVUA0030 DVUA0079 DVUA0081 DVUA0086 DVUA0099 DVUA0100 DVUA0101 DVUA0102 DVUA0103 DVUA0104 DVUA0106 DVUA0107 DVUA0108 DVUA0109 DVUA0113 DVUA0115 DVUA0116 DVUA0121 DVUA0122 DVUA0123 DVUA0126 DVUA0128 DVUA0131 DVUA0132 DVUA0147 | cysC escT invX | hypothetical protein | adenylylsulfate kinase | glycosyl transferase, group 1/2 family protein | response regulator | HAMP domain protein | sigma-54 dependent transcriptional regulator | type III secretion protein, hrpY/hrcU family | type III secretion inner membrane protein | type III secretion protein, HrpO family | type III secretion inner membrane protein, HrcV family | type III secretion target, YopN family | type III secretion system chaperone, LcrH/SycD family | type III secretion protein, YscD family | type III secretion system protein, YscF family | type III secretion system protein, YopQ family | type III secretion system protein | anti-anti-sigma factor | CRISPR-associated CT1133 family protein | CRISPR-associated TM1801 family protein |
132 | 24 | 365 | -32.709 | 0.476 | Residual = 0.476 | | AAGGaGga | GgtTgTCcACCGTATCGAAGA | | DVU0006 DVU0042 DVU0138 DVU0238 DVU0305 DVU0629 DVU0754 DVU0938 DVU0974 DVU0986 DVU0987 DVU1093 DVU1180 DVU1470 DVU1568 DVU1817 DVU1894 DVU1904 DVU2076 DVU2202 DVU2212 DVU2351 DVU2625 DVU2973 | ppiC cyf cheW-2 cheR-2 | universal stress protein family | RNA methyltransferase, TrmH family, group 3 | response regulator | hypothetical protein | ferredoxin II | transcriptional regulator, TetR family | isoamylase N-terminal domain protein | heavy metal-binding domain protein | HAD-superfamily hydrolase, subfamily IA, variant 3 | peptidyl-prolyl cis-trans isomerase C | ferritin | cytochrome c-553 | chemotaxis protein CheW | chemotaxis protein methyltransferase | transglycosylase SLT domain/bacterial extracellular solute-binding domain protein | integration host factor, beta subunit |
133 | 21 | 378 | -59.384 | 0.479 | Residual = 0.479 | | aGgagAAGGGAnGgCagttctAGC | aAcGGtaAAGtCAAggGCCTgcCA | | DVU0529 DVU0530 DVU0531 DVU0532 DVU0535 DVU0536 DVU0878 DVU0926 DVU0929 DVU0930 DVU1505 DVU1506 DVU1755 DVU2204 DVU2814 DVU2815 DVU2816 DVU2817 DVU2818 DVU2819 DVU3280 | hmcA obgE proB tnaA | transcriptional regulator, rrf2 protein, putative | response regulator, rrf1 protein | hmc operon protein 6 | hmc operon protein 5 | hmc operon protein 2 | high-molecular-weight cytochrome C | dnaK suppressor protein, putative | hypothetical protein | GTPase ObgE | gamma-glutamyl kinase | holin, putative | tryptophanase | outer membrane efflux protein | multidrug resistance protein | transcriptional regulator, TetR family |
134 | 14 | 356 | -38.771 | 0.547 | Residual = 0.547 | | CTtCaTGAacAagcCGTC | AgaGAcCctGaCACAccCatTAtC | | DVU0374 DVU0623 DVU0790 DVU1483 DVU1484 DVU1485 DVU1491 DVU1732 DVU2214 DVU2456 DVU2593 DVU2875 DVU2907 DVU2911 | umuD | pyruvate ferredoxin/flavodoxin oxidoreductase family protein | hypothetical protein | radical SAM protein, TIGR01212 family | tail fiber assembly protein, putative | DNA-binding domain, excisionase family | umuD protein | hemolysin A |
135 | 22 | 367 | -37.346 | 0.472 | Residual = 0.472 | | AAtATTGAaAAGACAATCGT | AGtCTAGGAAAtTCGtAcACG | | DVU0079 DVU0299 DVU0300 DVU0328 DVU0570 DVU0677 DVU0691 DVU0699 DVU1004 DVU1440 DVU1532 DVU1548 DVU1606 DVU2251 DVU2373 DVU2609 DVU2747 DVU2779 DVU2933 DVU3016 DVU3127 DVU3392 | rnc coaD pqiB glnA | ZIP zinc transporter family protein | anaerobic ribonucleoside triphosphate reductase | radical SAM domain protein | glycosyl transferase, group 1 family protein | hypothetical protein | transglycosylase domain protein | ribonuclease III | pantetheine-phosphate adenylyltransferase | outer membrane transport protein, OmpP1/FadL/TodX family | potassium uptake protein, TrkA family | DNA-binding protein | outer membrane protein, OMP85 family | chemotaxis MotB protein, putative | response regulator/sensory box/HDIG domain protein | B12 binding domain protein/radical SAM domain protein | paraquat-inducible protein B | glutamine synthetase, type I |
136 | 28 | 373 | -39.463 | 0.516 | Residual = 0.516 | | CATGAAgagaGGAGAaaAc | GaAGAggtcAgacgg | | DVU0490 DVUA0032 DVUA0033 DVUA0079 DVUA0081 DVUA0099 DVUA0100 DVUA0101 DVUA0104 DVUA0107 DVUA0108 DVUA0109 DVUA0111 DVUA0112 DVUA0113 DVUA0114 DVUA0115 DVUA0116 DVUA0117 DVUA0119 DVUA0121 DVUA0122 DVUA0123 DVUA0124 DVUA0126 DVUA0131 DVUA0147 DVUA0149 | cysC escJ | hypothetical protein | adenylylsulfate kinase | glycosyl transferase, group 1/2 family protein | HAMP domain protein | sigma-54 dependent transcriptional regulator | type III secretion protein, hrpY/hrcU family | type III secretion inner membrane protein, HrcV family | type III secretion system chaperone, LcrH/SycD family | type III secretion system protein, IpaC family, putative | type III secretion system protein, YscC family | type III secretion protein, YscD family | type III secretion system protein, YscF family | type III secretion lipoprotein | type III secretion system ATPase | type III secretion system protein, YopQ family | type III secretion system protein | anti-anti-sigma factor | sigma factor serine-protein kinase | CRISPR-associated CT1133 family protein |
137 | 24 | 370 | -22.745 | 0.593 | Residual = 0.593 | | CCgcCncgctnTncCaCaTtCCGC | TTTcCGAaGTcGa | | DVU0090 DVU0108 DVU0143 DVU0333 DVU0376 DVU0378 DVU0842 DVU0843 DVU1096 DVU1455 DVU1728 DVU1770 DVU1956 DVU2063 DVU2331 DVU2370 DVU2476 DVU2667 DVU2694 DVU2764 DVU2946 DVU3035 DVU3159 DVU3162 | wcaG argF hydB gltA gpsA | GDP-fucose synthetase | hypothetical protein | thioredoxin, putative | ornithine carbamoyltransferase | periplasmic [Fe] hydrogenase, small subunit | heptosyltransferase family protein | Smr family protein | outer membrane protein OmpH, putative | putative oxidoreductase | phosphate ABC transporter, periplasmic phosphate-binding protein, putative | nitroreductase family protein | methyl-accepting chemotaxis protein, putative | glycerol-3-phosphate dehydrogenase (NAD(P)+) | ABC transporter, periplasmic substrate-binding protein |
138 | 19 | 360 | -38.291 | 0.568 | Residual = 0.568 | | aaatATtATtTGCTTTTCAtaAt | ttAAtaATgCAcACA | | DVU0667 DVU0696 DVU1996 DVU2132 DVU2133 DVU2134 DVU2712 DVU2716 DVU2841 DVU3128 DVU3143 DVU3298 DVU3300 DVU3301 DVU3302 DVU3303 DVU3304 DVU3305 DVUA0136 | zupT | HD domain protein | hypothetical protein | quaternary ammonium compound-resistance protein QacC, putative | tail sheath protein, putative | type II restriction endonuclease, putative | lipoprotein, putative | iron-sulfur cluster-binding protein | ATP-dependent protease La, truncation | sigma-54 dependent transcriptional regulator/response regulator | zinc transporter ZupT |
139 | 30 | 365 | -47.356 | 0.531 | Residual = 0.531 | | AACCTTcaTCAATGAgAAGTTACA | TgcatgccgaAgtTCGTcaGGcGT | | DVU0027 DVU0095 DVU0096 DVU0339 DVU0432 DVU0493 DVU0953 DVU1390 DVU1411 DVU1530 DVU1539 DVU1608 DVU1917 DVU1918 DVU2347 DVU2683 DVU2790 DVU2791 DVU2792 DVU2793 DVU2794 DVU2795 DVU2796 DVU2797 DVU2798 DVU3026 DVU3028 DVU3033 DVU3101 DVU3371 | potC tyrS thiC glpX ligA hysB hysA argD metE | hypothetical protein | polyamine ABC transporter, periplasmic polyamine-binding protein | spermidine/putrescine ABC transporter membrane protein | D-isomer specific 2-hydroxyacid dehydrogenase family protein | Ech hydrogenase, subunit EchC, putative | tyrosyl-tRNA synthetase | thiamine biosynthesis protein ThiC | metallo-beta-lactamase family protein | fructose 1,6-bisphosphatase II | DNA ligase, NAD-dependent | periplasmic [NiFeSe] hydrogenase, small subunit | periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing | acetylornithine aminotransferase | L-lactate permease family protein | cytochrome c family protein | electron transport complex protein RnfC, putative | electron transport complex protein RnfD, putative | electron transport complex protein RnfG, putative | SoxR-reducing system protein RsxE | electron transport complex protein RnfA, putative | ferredoxin | ApbE family protein | iron-sulfur cluster-binding protein | tonB protein, putative | 5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase |
140 | 1 | 345 | -143.756 | 1.000 | Residual = 1.000 | |
|
| | DVU3130 | | hypothetical protein |
141 | 28 | 364 | -33.573 | 0.515 | Residual = 0.515 | | AtgTAAAgAAAaGctGtGaaACaC | GTAtCgTgtGGGCtTgcgCcc | | DVU0110 DVU0156 DVU0352 DVU0633 DVU0682 DVU0983 DVU1181 DVU1370 DVU1544 DVU1581 DVU2302 DVU2330 DVU2338 DVU2413 DVU2425 DVU2463 DVU2581 DVU2780 DVU2899 DVU2900 DVU2901 DVU2902 DVU2932 DVU3086 DVU3087 DVU3097 DVU3216 DVU3278 | rarD recN pyrB pyrC cobB-2 cobH | sigma-54 dependent transcriptional regulator/response regulator | ATP-dependent DNA helicase, UvrD/REP family | aminotransferase, DegT/DnrJ/EryC1/StrS family | penicillin-binding protein | DNA-binding protein, putative | hypothetical protein | response regulator | mechanosensitive ion channel family protein | glutathione-regulated potassium-efflux system protein KefB, putative | MRP family protein | DNA repair protein, HhH-GPD family | radical SAM domain protein | rarD protein | DNA repair protein RecN | amidohydrolase family protein | aspartate carbamoyltransferase catalytic subunit | dihydroorotase | conserved hypothetical protein TIGR01777 | cobyrinic acid a,c-diamide synthase | precorrin-8X methylmutase | outer membrane efflux protein | sensor histidine kinase | peptidase/PDZ domain protein |
142 | 1 | 354 | -146.490 | 1.000 | Residual = 1.000 | |
|
| | DVU3250 | | hypothetical protein |
143 | 23 | 360 | -39.855 | 0.478 | Residual = 0.478 | | AAcaTTtGcTTgattAaacT | TtGagtTcnncgcTgAAAtCCctT | | DVU0111 DVU0459 DVU0880 DVU1144 DVU1175 DVU1285 DVU1509 DVU1664 DVU1665 DVU1758 DVU1834 DVU1849 DVU2300 DVU2340 DVU2415 DVU2655 DVU2912 DVU3054 DVU3084 DVU3089 DVU3150 DVU3240 DVU3328 | aroQ pcm rpmE rpsA | response regulator | hypothetical protein | transcriptional regulator, Cro/CI family | GTPase EngB | 3-dehydroquinate dehydratase | lipoprotein, putative | pyruvate carboxylase | protein-L-isoaspartate O-methyltransferase | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | D-alanyl-D-alanine carboxypeptidase family protein | 50S ribosomal protein L31 | radical SAM domain protein | transcriptional regulator, putative | 30S ribosomal protein S1 | peptidase, M23/M37 family |
144 | 23 | 363 | -33.330 | 0.522 | Residual = 0.522 | | ggCAgGgCATcgtCaAngCca | AatCCGGATgCCCaCACCA | | DVU0134 DVU0427 DVU0747 DVU0861 DVU0962 DVU1157 DVU1158 DVU1163 DVU1697 DVU1727 DVU1856 DVU1959 DVU2071 DVU2075 DVU2099 DVU2273 DVU2393 DVU2737 DVU2809 DVU2811 DVU3322 DVU3323 DVU3324 | | glycosyl transferase, group 2 family protein | hypothetical protein | ABC transporter, ATP-binding protein | glycosyl transferase, group 1 family protein | sensory box histidine kinase | major facilitator superfamily protein | EAL domain/GGDEF domain protein | ParA family protein | carbon monoxide dehydrogenase accessory protein CooC, putative | RNA methyltransferase, TrmH family | cytochrome c3 | formate dehydrogenase, beta subunit, putative | ABC transporter, permease protein |
145 | 28 | 363 | -31.345 | 0.555 | Residual = 0.555 | | atTtcTTGaTTgatcAaACAGttt | cCcTgAccAcGcAAc | | DVU0041 DVU0092 DVU0876 DVU0952 DVU1057 DVU1058 DVU1460 DVU1937 DVU2083 DVU2285 DVU2286 DVU2287 DVU2289 DVU2291 DVU2328 DVU2580 DVU2619 DVU2944 DVU2945 DVU2980 DVU3005 DVU3157 DVU3158 DVU3177 DVU3190 DVU3221 DVU3273 DVUA0138 | cbiM relA pssA | transglycosylase, SLT family | sensory box histidine kinase | metallo-beta-lactamase family protein | conserved hypothetical protein TIGR00282 | cobalt ABC transporter, permease protein, putative | cobalt transport protein CbiM | hypothetical protein | phosphonate ABC transporter, periplasmic phosphonate-binding protein, putative | GTP pyrophosphokinase | L-lactate permease family protein | hydrogenase, CooM subunit, putative | hydrogenase, CooK subunit, selenocysteine-containing, putative | hydrogenase, CooX subunit, putative | carbon monoxide-induced hydrogenase CooH, putative | hydrogenase nickel insertion protein HypA, putative | response regulator | ErfK/YbiS/YcfS/YnhG family protein | CDP-diacylglycerol--serine O-phosphatidyltransferase | aminotransferase, DegT/DnrJ/EryC1/StrS family | vacJ lipoprotein, putative | sensor histidine kinase |
146 | 30 | 361 | -31.674 | 0.497 | Residual = 0.497 | | GcCaGcttCTACcGGA | CaAtACgcaTatACTcgGTGACgG | | DVU0041 DVU0841 DVU0896 DVU0899 DVU0936 DVU0965 DVU0966 DVU1038 DVU1064 DVU1067 DVU1238 DVU1392 DVU1406 DVU1423 DVU1615 DVU1910 DVU1954 DVU1990 DVU2056 DVU2150 DVU2251 DVU2364 DVU2782 DVU2783 DVU2791 DVU2940 DVU3171 DVU3187 DVU3238 DVU3277 | hisA purM lpdA paaK-2 nadD hup-4 | transglycosylase, SLT family | aspartate aminotransferase | lipoprotein, NLP/P60 family | hypothetical protein | amino acid ABC transporter, periplasmic amino acid-binding protein | phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase | aconitate hydratase | membrane protein, Bmp family | NLP/P60 family protein | phosphoribosylaminoimidazole synthetase | 2-oxoglutarate dehydrogenase, E3 component, lipoamide dehydrogenase | phenylacetate-coenzyme A ligase | YjeF-related protein | nicotinate (nicotinamide) nucleotide adenylyltransferase | dnaK suppressor protein, putative | DNA-binding protein | aminotransferase, classes I and II | cytochrome c family protein | cytochrome c3 | DNA-binding protein HU | response regulator |
147 | 1 | 360 | -141.352 | 1.000 | Residual = 1.000 | |
|
| | DVU3173 | | hypothetical protein |
148 | 25 | 366 | -38.263 | 0.455 | Residual = 0.455 | | GgtATGgTGCcGca | CTCCTTGC | | DVU0006 DVU0138 DVU0174 DVU0220 DVU0238 DVU0253 DVU0278 DVU0305 DVU0883 DVU1568 DVU1569 DVU1812 DVU1816 DVU1904 DVU2076 DVU2202 DVU2557 DVU2583 DVU2616 DVU2684 DVU2935 DVU2968 DVU3227 DVU3263 DVU3296 | porA cheW-2 cheR-2 birA gpm sdhB | universal stress protein family | response regulator | hypothetical protein | tail fiber protein, putative | oxidoreductase, FAD/iron-sulfur cluster-binding domain protein | glyoxalase family protein | ferredoxin II | glutaredoxin, putative | ferritin | pyruvate ferredoxin oxidoreductase, alpha subunit | cytochrome c oxidase, subunit II, putative | chemotaxis protein CheW | chemotaxis protein methyltransferase | transglycosylase SLT domain/bacterial extracellular solute-binding domain protein | birA bifunctional protein | lipoprotein, putative | sensory box histidine kinase/response regulator | phosphoglycerate mutase | sensor histidine kinase/response regulator | flagellar basal body-associated protein, putative | succinate dehydrogenase iron-sulfur subunit |
149 | 11 | 366 | -74.364 | 0.353 | Residual = 0.353 | | TtaACcgTcTCgAccAgAtAcTCa | TGTAAC | | DVU0545 DVU1433 DVU1696 DVU1884 DVU2165 DVU2327 DVU2426 DVU2480 DVU2595 DVU2664 DVU2820 | | hypothetical protein | methyl-accepting chemotaxis protein | lysozyme, putative | phosphate ABC transporter, ATP-binding protein, putative | amidohydrolase family protein |
150 | 29 | 363 | -26.710 | 0.541 | Residual = 0.541 | | ccATCaTC | GctGCGCAGTCAGgCGGC | | DVU0478 DVU0489 DVU0571 DVU0615 DVU0632 DVU0748 DVU0767 DVU0768 DVU0769 DVU1252 DVU1797 DVU1908 DVU1944 DVU2620 DVU2898 DVU2995 DVU2996 DVU2997 DVU2998 DVU3126 DVU3287 DVUA0061 DVUA0098 DVUA0112 DVUA0119 DVUA0124 DVUA0132 DVUA0134 DVUA0135 | paaK-1 ald acs murI ksgA pdxJ cas1 | Ser/Thr protein phosphatase family | phenylacetate-coenzyme A ligase | alanine dehydrogenase | hypothetical protein | cupin family protein | acetyl-CoA synthetase | aminotransferase, class V | glutamate racemase | pyridoxamine kinase | dimethyladenosine transferase | pyridoxal phosphate biosynthetic protein PdxJ | pyruvate ferredoxin oxidoreductase, iron-sulfur binding subunit, putative | glycosyl transferase, group 1 family protein | NAD-dependent epimerase/dehydratase family protein | glycosyl transferase, group 2 family protein | dehydrogenase, putative | type III secretion system protein, YscC family | type III secretion system ATPase | sigma factor serine-protein kinase | CRISPR-associated TM1801 family protein | CRISPR-associated protein Cas1 | CRISPR-associated protein Cas2 |
151 | 19 | 365 | -66.928 | 0.435 | Residual = 0.435 | | ATGAAGGtGanAaTTaCATG | TcCtTCCncCCCnGCCATttC | | DVU0873 DVU0874 DVU0956 DVU1287 DVU1288 DVU1289 DVU1293 DVU1574 DVU2231 DVU2518 DVU2519 DVU2922 DVU2923 DVU2924 DVU2925 DVU2926 DVU2927 DVU2928 DVU2929 | tsf rpsB rpsF rplY typA rplM rpsI secE nusG rplK rplA rplJ rplL rpoB rpoC | elongation factor Ts | 30S ribosomal protein S2 | 30S ribosomal protein S6 | reductase, iron-sulfur binding subunit, putative | cytochrome c family protein | hypothetical protein | 50S ribosomal protein L25/general stress protein Ctc | GTP-binding protein TypA | 50S ribosomal protein L13 | 30S ribosomal protein S9 | preprotein translocase subunit SecE | transcription antitermination protein NusG | 50S ribosomal protein L11 | 50S ribosomal protein L1 | 50S ribosomal protein L10 | 50S ribosomal protein L7/L12 | DNA-directed RNA polymerase subunit beta | DNA-directed RNA polymerase, beta prime subunit |
152 | 14 | 375 | -82.097 | 0.426 | Residual = 0.426 | | TATGAtcttnGGCATATT | TCtCTgaAACtGGAgCGTAgC | | DVU1486 DVU1487 DVU1489 DVU1494 DVU1495 DVU1497 DVU1501 DVU1502 DVU1503 DVU1504 DVU1505 DVU1506 DVU1523 DVU1972 | | tail fiber protein, truncation | hypothetical protein | head-tail adaptor, putative | ClpP protease family protein | portal protein, HK97 family | terminase, large subunit | terminase, small subunit | holin, putative |
153 | 23 | 360 | -25.592 | 0.541 | Residual = 0.541 | | cAGCAaGGAG | GGCAnGAtGCC | | DVU0068 DVU0239 DVU0253 DVU0411 DVU0456 DVU0624 DVU0625 DVU0676 DVU0819 DVU0995 DVU1569 DVU1570 DVU1816 DVU2348 DVU2543 DVU2544 DVU2589 DVU2590 DVU3259 DVU3262 DVU3294 DVU3319 DVUA0095 | porA porB dut xth fdrA NADP putA | hypothetical protein | oxidoreductase, FAD/iron-sulfur cluster-binding domain protein | heptosyltransferase family protein | DHH family protein | NapC/NirT cytochrome c family protein | cytochrome c nitrite reductase, catalytic subunit NfrA, putative | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | FMN reductase, NADPH-dependent | ThiJ/PfpI family protein | pyruvate ferredoxin oxidoreductase, alpha subunit | pyruvate ferredoxin oxidoreductase, beta subunit | deoxyuridine 5'-triphosphate nucleotidohydrolase | hydroxylamine reductase | iron-sulfur cluster-binding protein | sensory box protein | exodeoxyribonuclease III | fumarate reductase | aldehyde dehydrogenase (NADP) family protein | proline dehydrogenase/delta-1-pyrroline-5-carboxylate dehydrogenase |
154 | 15 | 366 | -65.426 | 0.379 | Residual = 0.379 | | GAAAAgCAgaCggAT | AaGgTtcaCCttTTTtGCCGCcAA | | DVU0670 DVU0967 DVU1027 DVU1276 DVU1294 DVU1626 DVU1662 DVU1671 DVU1672 DVU1919 DVU2306 DVU2356 DVU2367 DVU2842 DVU2891 | lpxA nikR | exopolysaccharide production protein, putative | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | hypothetical protein | permease, putative | ABC transporter, ATP-binding protein/permease protein | hydrogenase expression/formation protein, putative | phosphate transporter family protein | UDP-N-acetylglucosamine acyltransferase | type II DNA modification methyltransferase, putative | nickel responsive regulator |
155 | 32 | 369 | -35.907 | 0.578 | Residual = 0.578 | | GTtgTggcTCATGaAGntggtnt | ACgAGaCagCAcGnCgCgGGCAT | | DVU0354 DVU1439 DVU1473 DVU1475 DVU1815 DVU2162 DVU2366 DVU2379 DVU2380 DVU2382 DVU2384 DVU2385 DVU2386 DVU2387 DVU2388 DVU2389 DVU2390 DVU2394 DVU2395 DVU2396 DVU2397 DVU2398 DVU2399 DVU2400 DVU2401 DVU2402 DVU2403 DVU2404 DVU2405 DVU2406 DVU2459 DVU2882 | tolQ-1 hdrA hdrB hdrC folC | hypothetical protein | PhoU family protein | cytochrome c oxidase, subunit I, putative | peptidase, M16 family, putative | ABC transporter, ATP-binding protein | ABC transporter, periplasmic substrate-binding protein | ABC transporter, permease protein | tolQ protein | biopolymer transport protein, ExbD/TolR family | TonB domain protein | sigma-54 dependent transcriptional regulator/response regulator | sensor histidine kinase | alcohol dehydrogenase, iron-containing | hydrogenase, putative | hydrogenase, iron-sulfur cluster-binding subunit, putative | heterodisulfide reductase, A subunit | heterodisulfide reductase, B subunit | heterodisulfide reductase, C subunit | folylpolyglutamate synthase |
156 | 21 | 370 | -42.909 | 0.520 | Residual = 0.520 | | ATtTttatATgattttCaagaaa | AtatTGccTgTaaannttGtTTtC | | DVU0223 DVU0224 DVU0230 DVU1491 DVU1492 DVU1641 DVU1642 DVU1674 DVU1675 DVU1738 DVU1971 DVU2008 DVU2197 DVU2741 DVU2742 DVU2744 DVU2986 DVU2987 DVU2988 DVU3311 DVUA0084 | livG livM pspC pspA | hypothetical protein | transcriptional regulator cII, putative | transcriptional regulator, putative | site-specific recombinase, phage integrase family | high-affinity branched chain amino acid ABC transporter, ATP-binding protein | high-affinity branched chain amino acid ABC transporter, permease protein | high-affinity branched-chain amino acid ABC transporter, perisplasmic amino acid binding protein | phage shock protein C | phage shock protein A | transcriptional regulator, AbrB family |
157 | 26 | 369 | -23.587 | 0.565 | Residual = 0.565 | | TTtTTCAcTTTTaTAcT | TgAaacgaGGCAGCATCcgcCAAT | | DVU0035 DVU0177 DVU0240 DVU0246 DVU0454 DVU0459 DVU0500 DVU0773 DVU0853 DVU0893 DVU0975 DVU1006 DVU1177 DVU1178 DVU1179 DVU1674 DVU1675 DVU2428 DVU2451 DVU2523 DVU2788 DVU3083 DVU3084 DVU3193 DVU3228 DVU3238 | modA selB aor cheY-3 | hypothetical protein | molybdenum ABC transporter, periplasmic molybdenum-binding protein | pyruvate phosphate dikinase, PEP/pyruvate binding domain protein | selenocysteine-specific translation elongation factor | universal stress protein family | aldehyde:ferredoxin oxidoreductase, tungsten-containing | transcriptional regulator, putative | lipoprotein, putative | L-lactate permease family protein | transcriptional regulator, ArsR family | DNA-binding domain, excisionase family | chemotaxis protein CheY | response regulator |
158 | 13 | 369 | -63.226 | 0.382 | Residual = 0.382 | | tCCtGTTG | GATgAcGCCnCaCGTCaagGAtGC | | DVU0242 DVU0758 DVU0857 DVU0865 DVU0994 DVU1267 DVU1278 DVU1336 DVU1337 DVU1602 DVU1874 DVU2310 DVU2470 | ftsH clpX lon clpA clpB | SEC-C motif domain protein | hypothetical protein | radical SAM domain protein | membrane-associated zinc metalloprotease, putative | cell division protein FtsH | ATP-dependent protease ATP-binding subunit | ATP-dependent protease La | ATP-dependent Clp protease, ATP-binding subunit ClpA | ATP-dependent Clp protease, ATP-binding subunit ClpB | metallo-beta-lactamase family protein | membrane protein, putaive |
159 | 10 | 371 | -87.865 | 0.339 | Residual = 0.339 | | AtaTTCATtTaTAA | GTgcaAGATGa | | DVU1509 DVU1510 DVU1519 DVU1692 DVU2179 DVU2220 DVU2686 DVU2836 DVU2839 DVUA0017 | | hypothetical protein | transcriptional regulator, putative | ISDvu2, transposase OrfA | peptidase, S24 family |
160 | 21 | 365 | -21.442 | 0.594 | Residual = 0.594 | | GGCGtTGCgGGTgc | TGTGTTACGAATAATA | | DVU0178 DVU0479 DVU0617 DVU0710 DVU0877 DVU0914 DVU0948 DVU0949 DVU0950 DVU1055 DVU1111 DVU1217 DVU1659 DVU2111 DVU2751 DVU2772 DVU2784 DVU2785 DVU3130 DVU3237 DVU3241 | cobS | hypothetical protein | serine/threonine protein kinase, putative | competence protein comM, putative | cobalamin-5-phosphate synthase | heptosyltransferase family protein | MATE efflux family protein | transcriptional regulator, LysR family | dehydrogenase, FMN-dependent family | transcriptional regulator, GntR family | phosphoenolpyruvate synthase-related protein |
161 | 25 | 360 | -18.667 | 0.606 | Residual = 0.606 | | tCngCTGTCAtccCG | aTGTgtCGcnCAtGg | | DVU0038 DVU0071 DVU0089 DVU0213 DVU0332 DVU0391 DVU0435 DVU0455 DVU0485 DVU0804 DVU0971 DVU1100 DVU1159 DVU1160 DVU1566 DVU2092 DVU2123 DVU2124 DVU2361 DVU2462 DVU2544 DVU2629 DVU2834 DVU3195 DVU3203 | dinP | acyltransferase domain protein | DNA polymerase IV | hypothetical protein | sigma-54 dependent transcriptional regulator/response regulator | molybdenum cofactor biosynthesis protein | tail fiber protein, putative | urea transporter, putative | phosphoadenosine phosphosulfate reductase, putative | thiamine biosynthesis protein ThiF | oligopeptide ABC transporter, permease protein | iron-sulfur cluster-binding protein | lipoprotein, putative | DNA polymerase III, delta prime subunit, putative |
162 | 31 | 356 | -21.671 | 0.574 | Residual = 0.574 | | CGnAagaCAtGACA | CTgCcnGATGG | | DVU0029 DVU0071 DVU0077 DVU0080 DVU0104 DVU0127 DVU0154 DVU0184 DVU0194 DVU0291 DVU0292 DVU0295 DVU0346 DVU0347 DVU0540 DVU0569 DVU0585 DVU0740 DVU0844 DVU0859 DVU0907 DVU1389 DVU2315 DVU2619 DVU2866 DVU2867 DVU2883 DVU2970 DVU3013 DVU3022 DVU3335 | dinP fumC selA | hydantoinase/oxoprolinase family protein | DNA polymerase IV | hypothetical protein | fumarate hydratase | cation ABC transporter, permease protein, putative | terminase, large subunit, putative | ABC transporter, ATP-binding protein | amine oxidase, flavin-containing | transferase, hexapeptide repeat family | sensor histidine kinase | sigma-54 dependent transcriptional regulator | conserved hypothetical protein TIGR00257 | holin | selenocysteine synthase | acetyltransferase, GNAT family | glycosyl transferase, group 2 family protein | sensory box histidine kinase/response regulator | sensory box histidine kinase |
163 | 14 | 366 | -54.757 | 0.405 | Residual = 0.405 | | CccGCAcgAaGAACA | ATTtgTTTAAttAA | | DVU0506 DVU1246 DVU1292 DVU1682 DVU1843 DVU2051 DVU2371 DVU2372 DVU3070 DVU3088 DVUA0006 DVUA0068 DVUA0076 VIMSS_208926 | | DHH family protein | hypothetical protein | GAF domain protein | N-acetylmuramoyl-L-alanine amidase, putative | ATP-dependent RNA helicase, DEAD/DEAH box family | magnesium transporter MgtE, putative | ABC transporter, ATP-binding protein |
164 | 14 | 369 | -67.082 | 0.380 | Residual = 0.380 | | aaAaaCcTaGcAaAA | CcggtCtTGccGaCGtccggc | | DVU0074 DVU0153 DVU0157 DVU0321 DVU0657 DVU0792 DVU0793 DVU1041 DVU1242 DVU1407 DVU2227 DVU2323 DVU3174 DVU3186 | thiL tatC ubiE | polysaccharide biosynthesis domain protein | hypothetical protein | thiamin-monophosphate kinase | pantothenate kinase | heat shock protein, Hsp20 family | Sec-independent protein translocase TatC | vacJ lipoprotein, putative | radical SAM domain protein | ubiquinone/menaquinone biosynthesis methlytransferase UbiE |
165 | 15 | 371 | -51.385 | 0.420 | Residual = 0.420 | | tCtAaGAgcttGTtG | AAATnCTCAAcaTGCTTCC | | DVU1511 DVU1518 DVU1565 DVU1752 DVU2155 DVU2173 DVU2185 DVU2189 DVU2253 DVU2540 DVU3044 DVU3260 DVU3285 DVU3306 DVU3329 | | hypothetical protein | transcriptional regulator cI, truncation | terminase, large subunit, putative | transcriptional regulator cII, putative | 2-hydroxyglutaryl-CoA dehydratase, D-component |
166 | 30 | 359 | -22.309 | 0.576 | Residual = 0.576 | | GTCagtTGCnGTGnCgCA | agAACGGCaGCGACG | | DVU0015 DVU0072 DVU0284 DVU0438 DVU0439 DVU0481 DVU0764 DVU0823 DVU0827 DVU0828 DVU0830 DVU1065 DVU1186 DVU1236 DVU1237 DVU1270 DVU1344 DVU1608 DVU1610 DVU1660 DVU1933 DVU2523 DVU2553 DVU2582 DVU2677 DVU2683 DVU2748 DVU2749 DVU2979 DVU3060 | lgt ppiB-1 rfaD hup-2 argJ smpB ptsH mazG ispG ligA nadE cobM cobL | prolipoprotein diacylglyceryl transferase | glucose-1-phosphate cytidylyl-transferase | peptidyl-prolyl cis-trans isomerase B | AcrB/AcrD/AcrF family protein | YCII-related domain protein | ADP-L-glycero-D-mannoheptose-6-epimerase | DNA-binding protein HU | bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein | glycolate oxidase, subunit GlcD, putative | SsrA-binding protein | phosphocarrier protein HPr | peptidyl-prolyl cis-trans isomerse domain protein | nucleoside triphosphate pyrophosphohydrolase | amino acid ABC transporter, ATP-binding protein | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | twitching motility protein | 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase | DNA ligase, NAD-dependent | glutamine-dependent NAD+ synthetase | undecaprenol kinase, putative | peptidase, PfpI family | lipoprotein, putative | NifU family protein | transcriptional regulator, TetR family | sensor histidine kinase/response regulator | L-lactate permease family protein | precorrin-4 C11-methyltransferase | precorrin-6Y C5,15-methyltransferase (decarboxylating) | phosphatidylserine decarboxylase | hypothetical protein |
167 | 21 | 370 | -44.216 | 0.491 | Residual = 0.491 | | ATccATTcAcgAAGaCgGGAGCCG | CTCCACGgCcagcaTCcGCAA | | DVU0131 DVU0132 DVU0133 DVU0254 DVU0401 DVU0587 DVU0684 DVU1382 DVU1383 DVU1722 DVU1838 DVU1839 DVU1943 DVU2044 DVU2469 DVU2486 DVU2489 DVU3344 DVU3346 DVUA0029 DVUA0127 | fdnG-1 trxB-2 trx | hypothetical protein | formate dehydrogenase, alpha subunit, selenocysteine-containing | hflK protein, putative | HesB family selenoprotein | thioredoxin-disulfide reductase | thioredoxin | acetyltransferase, GNAT family |
168 | 15 | 362 | -69.358 | 0.388 | Residual = 0.388 | | CaACaTCATGgacGacaCgaAAc | GGAAtcGTGTagacAtCGT | | DVU1105 DVU1542 DVU1543 DVU1695 DVU2596 DVU2598 DVU2600 DVU2601 DVU2602 DVU2623 DVU2632 DVU2664 DVU2701 DVU2704 DVU2705 | hrpB | hypothetical protein | ATP-dependent helicase HrpB | tail fiber assembly protein, putative | phosphate ABC transporter, ATP-binding protein, putative | phage uncharacterized protein |
169 | 26 | 366 | -60.837 | 0.564 | Residual = 0.564 | | AAGaGactGagGtcTtaTaCC | aACcTGTGCaGgGctggCGAcATG | | DVU1002 DVU1003 DVU1194 DVU1195 DVU1196 DVU1198 DVU1200 DVU1201 DVU1202 DVU1203 DVU1204 DVU1205 DVU1206 DVU1207 DVU1209 DVU1210 DVU1211 DVU1780 DVU1781 DVU1782 DVU1783 DVU1784 DVU1785 DVU1891 DVU3176 DVU3177 | leuS ribH ribE ribD glyA fabF acpP fabG fabH rpmF rpmB | hypothetical protein | dnaJ domain protein | lipoprotein, putative | leucyl-tRNA synthetase | riboflavin synthase, beta subunit | riboflavin synthase subunit alpha | riboflavin biosynthesis protein RibD | cytidine/deoxycytidylate deaminase family protein | serine hydroxymethyltransferase | 3-oxoacyl-(acyl-carrier-protein) synthase II | acyl carrier protein | 3-oxoacyl-(acyl-carrier-protein) reductase | 3-oxoacyl-(acyl-carrier-protein) synthase III | ribosomal protein L32 | 50S ribosomal protein L28 | iron-sulfur cluster-binding protein | cysteine-rich domain protein | oxidoreductase, short-chain dehydrogenase/reductase family | membrane protein, MarC family | UDP-glucose/GDP-mannose dehydrogenase family protein |
170 | 24 | 373 | -44.074 | 0.484 | Residual = 0.484 | | AAaaatTcanaaTcttcTTccAaT | AtATCAtattaAtAtTcCAAACAG | | DVU0163 DVU0369 DVU0604 DVU1010 DVU1015 DVU1155 DVU1277 DVU1478 DVU1637 DVU1638 DVU1639 DVU1760 DVU1905 DVU1964 DVU1965 DVU2145 DVU2146 DVU2182 DVU2183 DVU2229 DVU2415 DVU2827 DVU2919 DVU3328 | motA-2 | lipoprotein, putative | hypothetical protein | transcriptional regulator, TetR family | transcriptional regulator, rrf2 protein, putative | chloramphenicol acetyltransferase, putative | chemotaxis protein MotA | sigma-54 dependent transcriptional regulator |
171 | 13 | 370 | -62.365 | 0.390 | Residual = 0.390 | | ActTttTTTgaAtta | AcAcaCAcAcGCAgCTTcCTA | | DVU0698 DVU0817 DVU0886 DVU1075 DVU1301 DVU1427 DVU1778 DVU1849 DVU2179 DVU2200 DVU2215 DVU2220 VIMSS_208926 | rfbC rnpA pcm | dTDP-4-dehydrorhamnose 3,5-epimerase | hypothetical protein | thioesterase family protein | ribonuclease P protein component | response regulator | cation efflux family protein | protein-L-isoaspartate O-methyltransferase | ISDvu2, transposase OrfA | RNA-binding protein |
172 | 28 | 367 | -33.217 | 0.553 | Residual = 0.553 | | AGCaTaCACCcCcagAACAGgACA | TAgTtatCaTCATttCtGgGATAA | | DVU0255 DVU0492 DVU0495 DVU0654 DVU0697 DVU0876 DVU0897 DVU0898 DVU0899 DVU0900 DVU1000 DVU1001 DVU1002 DVU1003 DVU1182 DVU1266 DVU1268 DVU1269 DVU1353 DVU1914 DVU2674 DVU2677 DVU3048 DVU3156 DVU3178 DVU3179 DVU3192 DVU3379 | argC gmk dnaE asd glmS ispB | hypothetical protein | N-acetyl-gamma-glutamyl-phosphate reductase | peptidase, U32 family | mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase | metallo-beta-lactamase family protein | RNA modification enzyme, MiaB-family | guanylate kinase | peptidase, M24 family | coenzyme A binding protein | dnaJ domain protein | DNA polymerase III, alpha subunit | putative alpha-isopropylmalate/homocitrate synthase family transferase | succinate dehydrogenase and fumarate reductase iron-sulfur protein | sensor histidine kinase/response regulator | aspartate-semialdehyde dehydrogenase | glucosamine--fructose-6-phosphate aminotransferase (isomerizing) | octaprenyl-diphosphate synthase | glycosyl transferase, group 1 family protein | ribonucleotide-diphosphate reductase subunit alpha |
173 | 9 | 369 | -102.207 | 0.289 | Residual = 0.289 | | CggcCCtGCCccAACCacc | TGACAAtG | | DVU0419 DVU0420 DVU0576 DVU2282 DVU2494 DVU2495 DVU2975 DVU2977 DVU2978 | nspC msrB | carboxynorspermidine decarboxylase | hypothetical protein | methionine sulfoxide reductase B | peptidase, M48 family | thioesterase family protein | hydrolase, putative | hydrolase, haloacid dehalogenase-like family |
174 | 26 | 366 | -26.605 | 0.537 | Residual = 0.537 | | GAaGAACTcGCCcAT | AcGaTACGGtacnGcncgTC | | DVU0169 DVU0362 DVU0480 DVU0569 DVU0654 DVU0911 DVU1172 DVU1271 DVU1635 DVU1961 DVU2144 DVU2322 DVU2368 DVU2369 DVU2576 DVU2693 DVU2905 DVU3013 DVU3022 DVU3046 DVU3050 DVU3109 DVU3163 DVU3164 DVU3179 DVU3181 | truA cheW-3 gap-2 fabZ lpxD ispB purL | oligopeptide/dipeptide ABC transporter, periplasmic oligopeptide/dipeptide-binding protein | hypothetical protein | sigma-54 dependent transcriptional regulator | peptidase, U32 family | tRNA pseudouridine synthase A | general secretion pathway protein F, putative | chemotaxis protein CheW | glyceraldehyde 3-phosphate dehydrogenase | UTP--glucose-1-phosphate uridylyltransferase, putative | beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ | UDP-3-O-(R-3-hydroxymyristoyl)-glucosamine N-acyltransferase | oligopeptide ABC transporter, ATP-binding protein | alcohol dehydrogenase, iron-containing | glycosyl transferase, group 2 family protein | sensory box histidine kinase/response regulator | glycosyl transferase, group 1 family protein | iron-sulfur cluster-binding protein | ABC transporter, permease protein | octaprenyl-diphosphate synthase | phosphoribosylformylglycinamidine synthase II |
175 | 32 | 373 | -20.028 | 0.588 | Residual = 0.588 | | ttTacTCCTTG | aAnnnGtCAtgaaAcACtTtTnCA | | DVU0137 DVU0493 DVU0571 DVU0902 DVU1032 DVU1159 DVU1218 DVU1222 DVU1241 DVU1475 DVU1534 DVU1771 DVU1817 DVU1853 DVU1991 DVU1999 DVU2005 DVU2019 DVU2020 DVU2431 DVU2670 DVU2763 DVU2776 DVU2813 DVU2973 DVU3047 DVU3104 DVU3213 DVU3268 DVUA0026 DVUA0027 DVUA0028 | ald hydC cyf dsvC | hypothetical protein | alanine dehydrogenase | TPR domain protein | PhoU family protein | [Fe] hydrogenase gamma | cytochrome c-553 | sulfate transporter family protein | TPR/GGDEF domain protein | dissimilatory sulfite reductase, gamma subunit | integration host factor, beta subunit | aminotransferase, class IV | peptidoglycan-associated lipoprotein, putative |
176 | 30 | 369 | -30.258 | 0.544 | Residual = 0.544 | | AgtTngCGGCGGGCgaCgacCcG | CCcCGgAAcGcGCCTTCGGCGCG | | DVU0237 DVU0296 DVU0414 DVU0481 DVU0487 DVU0489 DVU0632 DVU0633 DVU0635 DVU0646 DVU0648 DVU0649 DVU0650 DVU0726 DVU0795 DVU1028 DVU1187 DVU1426 DVU1609 DVU1769 DVU1903 DVU2142 DVU2209 DVU2315 DVU3008 DVU3009 DVU3011 DVU3064 DVU3190 DVU3192 | serS rfaD purE paaK-1 cobI tgt purC cmk gcvH dapB hydA mfd surE | seryl-tRNA synthetase | peptidase, M24 family | NADP-dependent malic enzyme-related protein | ADP-L-glycero-D-mannoheptose-6-epimerase | phosphoribosylaminoimidazole carboxylase, catalytic subunit | phenylacetate-coenzyme A ligase | cupin family protein | penicillin-binding protein | dolichyl-phosphate-mannose-protein mannosyltransferase family protein | precorrin-2 C20-methyltransferase | iron compound ABC transporter, ATP-binding protein | iron compound ABC transporter, permease protein | chelatase, putative | queuine tRNA-ribosyltransferase | phosphoribosylaminoimidazole-succinocarboxamide synthase | cytidylate kinase | hypothetical protein | glycine cleavage system H protein | dihydrodipicolinate reductase | periplasmic [Fe] hydrogenase, large subunit | transcription-repair coupling factor | acid phosphatase SurE | conserved hypothetical protein TIGR00257 | NeuB family protein | radical SAM domain protein | sensory box/GGDEF domain/EAL domain protein | glycosyl transferase, group 1 family protein |
177 | 12 | 365 | -73.746 | 0.335 | Residual = 0.335 | |
|
| | DVU1303 DVU1308 DVU1309 DVU1310 DVU1320 DVU1324 DVU1325 DVU1326 DVU1327 DVU1328 DVU1329 DVU1330 | rplC rplV rpsC rplP rpsE map rpmJ rpsM rpsK rpsD rpoA rplQ | 50S ribosomal protein L3 | 50S ribosomal protein L22 | 30S ribosomal protein S3 | 50S ribosomal protein L16 | 30S ribosomal protein S5 | methionine aminopeptidase, type I | 50S ribosomal protein L36 | 30S ribosomal protein S13 | 30S ribosomal protein S11 | 30S ribosomal protein S4 | DNA-directed RNA polymerase subunit alpha | 50S ribosomal protein L17 |
178 | 10 | 363 | -15.688 | 0.542 | Residual = 0.542 | | GGTGGTtA | AATGAT | | DVU0491 DVU0589 DVU1221 DVU1668 DVU1933 DVU2138 DVU2342 DVU3041 DVU3272 DVUA0085 | | HDIG domain protein | molybdopterin-guanine dinucleotide biosynthesis protein B, putative | hypothetical protein | outer membrane lipoprotein carrier protein, putative | peptidase, PfpI family | amino acid ABC transporter, periplasmic amino acid-binding protein | cytochrome c553 | TPR domain protein |
179 | 31 | 367 | -21.594 | 0.566 | Residual = 0.566 | | GCAGAATAgCTGgTTCAACATGA | GaaACaATCTGTgGTAcGAGA | | DVU0065 DVU0269 DVU0354 DVU0455 DVU0504 DVU0602 DVU1010 DVU1084 DVU1086 DVU1154 DVU1256 DVU1331 DVU1333 DVU1759 DVU1777 DVU1971 DVU2073 DVU2098 DVU2181 DVU2208 DVU2214 DVU2267 DVU2297 DVU2652 DVU2653 DVU2669 DVU2672 DVU2738 DVU2882 DVU3395 DVUA0085 | rpsO pstB-1 cynT cheY-2 cooS folC | hypothetical protein | transcriptional regulator, rrf2 protein, putative | 30S ribosomal protein S15 | phosphate ABC transporter, ATP-binding protein | heptosyltransferase family protein | transcriptional regulator, LysR family | molybdenum-binding protein, HTH domain | carbonic anhydrase | chemotaxis protein CheY | carbon monoxide dehydrogenase | antirepressor, putative | glycine/betaine/L-proline ABC transporter, periplasmic-binding protein | methyl-accepting chemotaxis protein | folylpolyglutamate synthase | peptidase, M23/M37 family |
180 | 20 | 366 | -47.288 | 0.431 | Residual = 0.431 | | cnCgaCGCCGnACgC | gCCCnGcCatcaCga | | DVU0142 DVU0338 DVU0350 DVU0353 DVU0495 DVU0653 DVU1039 DVU1040 DVU1185 DVU1424 DVU1927 DVU2210 DVU2575 DVU2757 DVU2892 DVU2942 DVU2951 DVU3006 DVU3167 DVU3198 | trpS spsF hisB gcvPB ileS purB glnS | tryptophanyl-tRNA synthetase | hydrolase, haloacid dehalogenase-like family | spore coat polysaccharide biosynthesis protein spsF | alcohol dehydrogenase, iron-containing | hypothetical protein | sigma-54 dependent transcriptional regulator, putative/response regulator | lipoprotein, putative | imidazoleglycerol-phosphate dehydratase | colicin V production family protein | glycine dehydrogenase subunit 2 | isoleucyl-tRNA synthetase | TPR domain protein | peptidase, M20/M25/M40 family | radical SAM domain protein | adenylosuccinate lyase | glutaminyl-tRNA synthetase | polysaccharide biosynthesis protein/methyltransferase, putative | heme biosynthesis protein, putative | DNA polymerase III, gamma and tau subunits, putative |
181 | 29 | 361 | -31.065 | 0.474 | Residual = 0.474 | | ATAAaGTCtAnCtaAAACAcA | GAcGGCAAGgc | | DVU0009 DVU0067 DVU0102 DVU0126 DVU0249 DVU0308 DVU0324 DVU0346 DVU0363 DVU0736 DVU1037 DVU1173 DVU1604 DVU1662 DVU1683 DVU1744 DVU2358 DVU2618 DVU2730 DVU2743 DVU2761 DVU2787 DVU2823 DVU2871 DVU3040 DVU3043 DVU3081 DVU3108 DVU3267 | pabB purN mviN-1 livH nhaC-2 | TRAP transporter, DctM subunit | hypothetical protein | cation ABC transporter, periplasmic binding protein | ABC transporter, ATP-binding protein | para-aminobenzoate synthase, component I | phosphoribosylglycinamide formyltransferase | mercuric reductase, putative | integral membrane protein MviN | permease, putative | DNA-binding protein | tail fiber protein, putative | high-affinity branched-chain amino acid ABC ransporter, permease protein | TRAP transporter, DctMQ subunit | minor capsid protein C | Na+/H+ antiporter NhaC |
182 | 13 | 366 | -71.240 | 0.370 | Residual = 0.370 | | CTCATGCCcccGCA | CTCTTGCa | | DVU0010 DVU0039 DVU1112 DVU1713 DVU2688 DVU2689 DVU2690 DVU2691 DVU2692 DVU2710 DVU2714 DVU2715 DVU3370 | | TRAP transporter, DctQ subunit | C4-type zinc finger protein, DksA/TraR family | hypothetical protein | bacteriophage transposase A protein | bacteriophage DNA transposition B protein |
183 | 8 | 350 | -26.547 | 0.592 | Residual = 0.592 | | GTTccgCtgCgtAAtCcgCCT | GCCACA | | DVU0116 DVU1099 DVU1134 DVU1139 DVU2188 DVU2603 DVU2605 DVU2705 | hupB | polysaccharide deacetylase family protein | tail fiber assembly protein, putative | DNA-binding protein HU, beta subunit | bacteriophage DNA transposition B protein, putative | primase, putative | hypothetical protein | phage uncharacterized protein |
184 | 30 | 376 | -48.521 | 0.485 | Residual = 0.485 | | caTGGaacGTgccTTGCtt | AACACcaTGGAATAgAA | | DVU0044 DVU0046 DVU0047 DVU0310 DVU0311 DVU0312 DVU0313 DVU0314 DVU0315 DVU0409 DVU0512 DVU0513 DVU0515 DVU0516 DVU0517 DVU0519 DVU0520 DVU0521 DVU0522 DVU0858 DVU0862 DVU0863 DVU0913 DVU2211 DVU2232 DVU3001 DVU3003 DVU3018 DVU3019 DVU3020 | fliP fliN fliI fliG fliF fliE flgC flgG flgH flgI csrA | flagellar biosynthesis protein FliP | flagellar motor switch protein FliN | flagellar protein FliL | flagellum-specific ATP synthase FliI | flagellar assembly protein FliH, putative | flagellar motor switch protein FliG | flagellar M-ring protein FliF | flagellar basal body component FliE | flagellar basal-body rod protein FlgC | hypothetical protein | flagellar basal-body rod protein, putative | flagellar basal body rod protein FlgG | flagellar basal body L-ring protein | flagellar basal body P-ring protein | peptidase, M23/M37 family | flagellar hook-associated protein FlgK, putative | flagellar hook-associated protein FlgL, putative | carbon storage regulator | flagellar assembly protein FliW | lipoprotein, putative | flagellar protein FliS/hypothetical protein, fusion | flagellar hook-associated protein 2, putative | radical SAM domain protein | radical SAM/B12 binding domain protein |
185 | 30 | 365 | -17.503 | 0.611 | Residual = 0.611 | | GCnTCGCAACG | CCTTCCGGCAG | | DVU0029 DVU0045 DVU0048 DVU0055 DVU0059 DVU0130 DVU0134 DVU0292 DVU0392 DVU0400 DVU0661 DVU0688 DVU0723 DVU0818 DVU1113 DVU1160 DVU1507 DVU2080 DVU2233 DVU2234 DVU2413 DVU2493 DVU2520 DVU2759 DVU2821 DVU3074 DVU3091 DVU3321 DVU3369 DVUA0138 | ispH purT | hydantoinase/oxoprolinase family protein | flagellar biosynthesis protein, FliO, putative | chemotaxis protein MotB | hydroxymethylbutenyl pyrophosphate reductase | AcrB/AcrD/AcrF family protein | phosphoglycolate phosphatase, putative | glycosyl transferase, group 2 family protein | hypothetical protein | aromatic aminotransferase | dihydrouridine synthase family protein | phosphoribosylglycinamide formyltransferase 2 | urea transporter, putative | conserved hypothetical protein TIGR00275 | radical SAM domain protein | iron-sulfur cluster-binding protein | sensor histidine kinase |
186 | 23 | 364 | -30.180 | 0.513 | Residual = 0.513 | | AGTTCAaGTCT | TTTCTTTTTaT | | DVU0873 DVU0874 DVU0958 DVU0959 DVU1021 DVU1022 DVU1842 DVU1896 DVU1930 DVU2028 DVU2097 DVU2143 DVU2519 DVU2531 DVU2533 DVU2534 DVU2535 DVU2536 DVU2537 DVU2921 DVU3071 DVU3103 DVU3273 | tsf rpsB rplI dnaB rpsT fba rpsI rpe pheT pheS rplT rpmI infC rpmG | elongation factor Ts | 30S ribosomal protein S2 | 50S ribosomal protein L9 | replicative DNA helicase | hypothetical protein | SUF system FeS assembly ATPase SufC, putative | lipoprotein, putative | 30S ribosomal protein S20 | TPR domain protein | transcriptional regulator, putative | fructose-1,6-bisphosphate aldolase, class II | 30S ribosomal protein S9 | ribulose-phosphate 3-epimerase | phenylalanyl-tRNA synthetase, beta subunit | phenylalanyl-tRNA synthetase, alpha subunit | 50S ribosomal protein L20 | 50S ribosomal protein L35 | translation initiation factor IF-3 | 50S ribosomal protein L33 | oxidoreductase, FAD/iron-sulfur cluster-binding domain protein | tolB protein, putative |
187 | 19 | 366 | -50.821 | 0.418 | Residual = 0.418 | | GCAnGgtgGngAAacgaGtTga | TTCCTTgCGAt | | DVU0669 DVU1019 DVU1020 DVU1351 DVU1361 DVU1480 DVU1533 DVU1688 DVU1859 DVU1966 DVU2114 DVU2128 DVU2392 DVU2409 DVU2569 DVU3080 DVUA0017 DVUA0067 DVUA0068 | lpxB miaA | hypothetical protein | HD domain/sensory box protein | membrane protein, MarC family | lipid A disaccharide synthase | tRNA delta(2)-isopentenylpyrophosphate transferase | 1-acyl-sn-glycerol-3-phosphate acyltransferase, putative | sigma-54 dependent transcriptional regulator/response regulator | type III secretion chaperone, CesT family | bacterial extracellular solute-binding proteins, family 3 | peptidyl-prolyl cis-trans isomerase, FKBP-type | transcriptional regulator, putative |
188 | 25 | 364 | -26.184 | 0.553 | Residual = 0.553 | | CtTTtCcgaA | GCgtaccGCATcggGgCAtCcC | | DVU0274 DVU0836 DVU0840 DVU0950 DVU0957 DVU0958 DVU0959 DVU1021 DVU1022 DVU1282 DVU1455 DVU1624 DVU1625 DVU1627 DVU1635 DVU1841 DVU2252 DVU2522 DVU2903 DVU2921 DVU3070 DVU3071 DVU3207 DVU3274 DVU3367 | trmD ffh rpsR rplI dnaB glmM kdsA fbp dnaA-2 rpmG aspS | hypothetical protein | tRNA (guanine-N1)-methyltransferase | signal recognition particle protein | 30S ribosomal protein S18 | 50S ribosomal protein L9 | replicative DNA helicase | SUF system FeS assembly ATPase SufC, putative | phosphoglucosamine mutase | 2-dehydro-3-deoxyphosphooctonate aldolase | phosphatase, YrbI family | ABC transporter, ATP-binding protein | fructose-1,6-bisphosphatase | chromosomal replication initiator protein DnaA | HD domain protein | 50S ribosomal protein L33 | oxidoreductase, FAD/iron-sulfur cluster-binding domain protein | RNB-like family protein | aspartyl-tRNA synthetase |
189 | 15 | 368 | -81.324 | 0.341 | Residual = 0.341 | | AtaCAcggTggAAgG | CGCcTGtCgcA | | DVU0529 DVU0530 DVU0531 DVU0532 DVU0533 DVU0534 DVU0535 DVU0536 DVU0586 DVU0588 DVU0596 DVU0597 DVU0598 DVU0599 DVU2294 | hmcA lytR lytS | transcriptional regulator, rrf2 protein, putative | response regulator, rrf1 protein | hmc operon protein 6 | hmc operon protein 5 | hmc operon protein 4 | hmc operon protein 3 | hmc operon protein 2 | high-molecular-weight cytochrome C | hypothetical protein | formate dehydrogenase, beta subunit, putative | DNA-binding response regulator LytR | regulatory protein LytS | carbon starvation protein A, putative | femAB family protein |
190 | 21 | 371 | -55.951 | 0.424 | Residual = 0.424 | | AcnaCAtAAAA | ATgTtcgtcAATntnggtcac | | DVU0371 DVU0554 DVU0555 DVU0556 DVU0557 DVU0558 DVU0559 DVU0560 DVU0561 DVU0562 DVU1147 DVU1152 DVU1166 DVU1167 DVU1692 DVU1947 DVU1948 DVU2010 DVU2174 DVU2175 DVU2177 | | hypothetical protein | NAD-dependent epimerase/dehydratase family protein | ISDvu3, transposase OrfA | lipoprotein, putative | glycosyl transferase, group 1 family protein | ISD1, transposase OrfA | alginate o-acetyltransferase AlgI, putative | pyruvate ferredoxin oxidoreductase, gamma subunit, putative | ISD1, transposase OrfB | adenine specific DNA methyltransferase, putative |
191 | 23 | 374 | -58.809 | 0.445 | Residual = 0.445 | | AcaTTGAaAATCaTtaTCAATA | ACACCAAtAggCCGgaACATG | | DVU0273 DVU0303 DVU0304 DVU0762 DVU0763 DVU2377 DVU2378 DVU2379 DVU2380 DVU2383 DVU2388 DVU2389 DVU2390 DVU2571 DVU2572 DVU2573 DVU2574 DVU2680 DVU2681 DVU3122 DVU3331 DVU3332 DVU3333 | tolQ-1 feoB | hypothetical protein | GGDEF domain protein | transcriptional regulator, AraC family | peptidase, M16 family, putative | ABC transporter, ATP-binding protein | tonB dependent receptor domain protein | tolQ protein | biopolymer transport protein, ExbD/TolR family | TonB domain protein | ferrous iron transport protein B | ferrous iron transport protein A, putative | ferrous ion transport protein, putative | flavodoxin | heavy metal translocating P-type ATPase |
192 | 37 | 358 | -24.620 | 0.538 | Residual = 0.538 | | gGtttTGGCGT | GCATCGcATgT | | DVU0175 DVU0456 DVU0580 DVU0600 DVU0626 DVU0627 DVU0701 DVU1037 DVU1396 DVU1413 DVU1420 DVU1471 DVU1472 DVU1592 DVU1594 DVU1596 DVU1613 DVU1614 DVU1958 DVU1986 DVU2349 DVU2360 DVU2421 DVU2422 DVU2482 DVU2895 DVU2968 DVU2976 DVU3037 DVU3077 DVU3147 DVU3148 DVU3217 DVU3282 DVUA0021 DVUA0023 DVUA0091 | moaA ldh ilvN-1 ptB glcB cheA-1 cheB-1 fdnG-2 malQ katA | tungsten formylmethanofuran dehydrogenase family protein/molybdopterin binding protein | DHH family protein | molybdenum cofactor biosynthesis protein A | L-lactate dehydrogenase | acetolactate synthase, small subunit | phosphotransbutyrylase | malate synthase G | mercuric reductase, putative | hypothetical protein | Hpt domain protein | heat shock protein, Hsp20 family | ATP-dependent protease, putative | arginine N-succinyltransferase, beta subunit, putative | chemotaxis protein CheA | protein-glutamate methylesterase CheB | putative glutamate synthase subunit beta | iron-sulfur cluster-binding protein | sensory box histidine kinase | carbohydrate phosphorylase family protein | oxidoreductase, FAD/NAD-binding family | 4-oxalocrotonate tautomerase family protein | nitroreductase family protein | formate dehydrogenase, alpha subunit, selenocysteine-containing | sensor histidine kinase/response regulator | rhodanese-like domain protein | AhpC/TSA family protein | 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase | 4-alpha-glucanotransferase | ADP-ribosylglycohydrolase family protein | ABC transporter, permease protein, putative | catalase |
193 | 19 | 372 | -44.112 | 0.455 | Residual = 0.455 | | GtCAACAcgCCGtAA | GnCGACagGngCAacGCAacA | | DVU0069 DVU0316 DVU0488 DVU0494 DVU0514 DVU0668 DVU1602 DVU1940 DVU1941 DVU1957 DVU2217 DVU2326 DVU2549 DVU2550 DVU3082 DVU3162 DVU3257 DVU3387 DVUA0092 | flgB purD clpA | hypothetical protein | flagellar basal body rod protein FlgB | phosphoribosylamine--glycine ligase | aminotransferase, class V | FlgA family protein | methyl-accepting chemotaxis protein | ATP-dependent Clp protease, ATP-binding subunit ClpA | anaerobic glycerol-3-phosphate dehydrogenase, A subunit, putative | HAD-superfamily hydrolase, subfamily IIA | acetyltransferase, GNAT family | ABC transporter, periplasmic substrate-binding protein | DNA internalization-related competence protein ComEC/Rec2 |
194 | 22 | 363 | -33.674 | 0.460 | Residual = 0.460 | | ggcGCAtCctC | ATAGCCAG | | DVU0256 DVU0395 DVU0396 DVU0595 DVU0683 DVU0684 DVU0725 DVU0853 DVU0910 DVU0963 DVU1012 DVU1603 DVU1830 DVU2324 DVU2468 DVU2470 DVU2489 DVU2547 DVU2548 DVU2630 DVU2974 DVU3344 | hup-1 fliM aat lpxK acpD | ATP-dependent RNA helicase, DEAD/DEAH box family | HIT family protein | DNA-binding protein HU | hypothetical protein | hflC protein, putative | hflK protein, putative | flagellar motor switch protein FliM | 7-cyano-7-deazaguanine reductase | hemolysin-type calcium-binding repeat protein | leucyl/phenylalanyl-tRNA--protein transferase | copper-translocating P-type ATPase | tetraacyldisaccharide 4'-kinase | membrane protein, putaive | transcriptional regulator, putative | acyl carrier protein phosphodiesterase | lipoprotein, putative |
195 | 24 | 365 | -39.039 | 0.568 | Residual = 0.568 | | ATAcAaGACAaGgTTTTccTgA | TTcgTTgcAgaGGgC | | DVU0334 DVU0698 DVU0951 DVU1017 DVU1018 DVU1043 DVU1046 DVU1339 DVU1340 DVU1341 DVU1342 DVU1343 DVU1344 DVU1345 DVU1346 DVU1349 DVU1350 DVU2275 DVU2425 DVU2638 DVU2783 DVU3011 DVU3379 DVUA0111 | rfbC guaA ispG proS xseA dxs rarD | D-alanine--D-alanine ligase | dTDP-4-dehydrorhamnose 3,5-epimerase | molybdopterin biosynthesis MoeA protein, putative | ABC transporter, ATP-binding protein/permease protein | type I secretion membrane fusion protein, HlyD family | bifunctional GMP synthase/glutamine amidotransferase protein | hypothetical protein | lipoprotein, putative | transcriptional regulator, Fur family | cation ABC transporter, permease protein | cation ABC transporter, ATP-binding protein, putative | cation ABC transporter, periplasmc-binding protein | 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase | prolyl-tRNA synthetase | exodeoxyribonuclease VII, large subunit | geranylgeranyl diphosphate synthase | 1-deoxy-D-xylulose-5-phosphate synthase | sigma-54 dependent transcriptional regulator | rarD protein | ribonucleotide-diphosphate reductase subunit alpha | type III secretion system protein, IpaC family, putative |
196 | 20 | 365 | -64.511 | 0.382 | Residual = 0.382 | | AAnnTcaAnnnTtgcacnAAAAAa | TTccccaTCaA | | DVU1408 DVU1653 DVU1914 DVU1985 DVU1990 DVU2009 DVU2012 DVU2015 DVU2016 DVU2027 DVU2032 DVU2034 DVU2038 DVU2044 DVU2045 DVU2047 DVU2049 DVU2057 DVU2087 DVU2089 | | hypothetical protein | polyA polymerase family protein | putative alpha-isopropylmalate/homocitrate synthase family transferase | GGDEF domain protein | ERF family protein |
197 | 18 | 371 | -42.714 | 0.447 | Residual = 0.447 | | ACTTGAgtaTtTATTA | TGAAACGAGGAGAA | | DVU0621 DVU1724 DVU2692 DVU2706 DVU2881 DVU3142 DVUA0012 DVUA0031 DVUA0032 DVUA0034 DVUA0035 DVUA0038 DVUA0042 DVUA0054 DVUA0093 DVUA0102 DVUA0128 DVUA0136 | nifD escT zupT | sigma-54 dependent DNA-binding response regulator | phage uncharacterized protein, putative | hypothetical protein | phage/plasmid primase, P4 family | sigma-54 dependent transcriptional regulator | nitrogenase molybdenum-iron protein alpha chain | capsular polysaccharide transport protein | lipoprotein, putative | glycosyl transferase, group 1 family protein | chromate transport family protein | type III secretion inner membrane protein | zinc transporter ZupT |
198 | 39 | 365 | -18.756 | 0.586 | Residual = 0.586 | | CAAGGAGCaca | TcTTCcGG | | DVU0112 DVU0221 DVU0540 DVU0608 DVU0615 DVU0619 DVU0676 DVU0683 DVU0721 DVU0741 DVU0744 DVU0755 DVU0803 DVU0855 DVU0903 DVU0910 DVU0992 DVU1279 DVU1338 DVU1447 DVU1448 DVU1549 DVU1771 DVU1803 DVU1830 DVU1939 DVU1986 DVU2019 DVU2091 DVU2142 DVU2361 DVU2391 DVU2763 DVU2813 DVU2934 DVU3220 DVU3222 DVU3225 DVU3266 | fliM cheV-3 folP hydC thiE-1 surE pgi | deoxyribodipyrimidine photolyase, putative | tail fiber assembly protein, putative | sensor histidine kinase | methyl-accepting chemotaxis protein | hypothetical protein | sigma-54 dependent transcriptional regulator | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | hflC protein, putative | sensory box histidine kinase | sigma-54 dependent transcriptional regulator/response regulator | sensor histidine kinase, putative | radical SAM domain protein | HD domain protein | flagellar motor switch protein FliM | chemotaxis protein CheV | dihydropteroate synthase | CgeB family protein | [Fe] hydrogenase gamma | glycosyl transferase, group 1 family protein | anaerobic glycerol-3-phosphate dehydrogenase subunit B | thiamine-phosphate pyrophosphorylase | acid phosphatase SurE | TPR/GGDEF domain protein | glucose-6-phosphate isomerase |
199 | 13 | 369 | -100.228 | 0.276 | Residual = 0.276 | | CTTcGTC | CGATGcCG | | DVU0198 DVU0199 DVU0200 DVU0201 DVU0202 DVU0203 DVU0204 DVU0205 DVU0208 DVU2862 DVU2863 DVU2869 DVU2870 | | minor capsid protein C, degenerate | hypothetical protein | major head protein | holin | lipoprotein, putative |
200 | 17 | 373 | -60.028 | 0.408 | Residual = 0.408 | | CTTTTCAAGGAACCGAA | TCgcCtTctCTgTC | | DVU0086 DVU2457 DVU2458 DVU3105 DVUA0040 DVUA0045 DVUA0047 DVUA0048 DVUA0055 DVUA0057 DVUA0058 DVUA0059 DVUA0060 DVUA0062 DVUA0063 DVUA0141 DVUA0146 | | hypothetical protein | polysaccharide biosynthesis protein, putative | aminotransferase, DegT/DnrJ/EryC1/StrS family | exopolysaccharide production protein, putative | sigma-54 dependent transcriptional regulator/response regulator | BNR/Asp-box repeat protein | Orn/DAP/Arg family decarboxylase |
201 | 18 | 367 | -33.554 | 0.496 | Residual = 0.496 | | aGGgCacGACGCCCATCgTTG | TTTCAGGaGat | | DVU0069 DVU0256 DVU0396 DVU0655 DVU0803 DVU0963 DVU1030 DVU1410 DVU1437 DVU1438 DVU2005 DVU2547 DVU2549 DVU2550 DVU2894 DVU3213 DVU3337 DVUA0097 | hup-1 kdpC | hypothetical protein | ATP-dependent RNA helicase, DEAD/DEAH box family | DNA-binding protein HU | PHP domain protein | sensor histidine kinase | 7-cyano-7-deazaguanine reductase | universal stress protein family | cobyrinic acid a,c-diamide synthase family protein | transcriptional regulator, putative | sigma-54 dependent transcriptional regulator | K+-transporting ATPase, C subunit | radical SAM domain protein |
202 | 20 | 362 | -29.622 | 0.583 | Residual = 0.583 | | GTaGAACACTTCtgtgTtCTCGA | GCATCACCGtACtGgTgTaGC | | DVU0498 DVU0628 DVU0735 DVU0737 DVU0738 DVU0739 DVU0816 DVU0878 DVU1024 DVU1034 DVU1297 DVU1385 DVU1431 DVU1836 DVU1885 DVU1955 DVU2295 DVU3058 DVU3334 DVUA0129 | buk cobQ rluD/coaE gatB cas3 | iron-sulfur cluster-binding protein, putative | butyrate kinase | MOSC domain protein | sensory box histidine kinase | substrate-binding protein, putative | conserved hypothetical protein TIGR00296 | cobyric acid synthase CobQ | dnaK suppressor protein, putative | ribosomal large subunit pseudouridine synthase D/dephospho-CoA kinase | hypothetical protein | hpt domain protein/STAS domain protein | tRNA nucleotidyltransferase, putative | aspartyl/glutamyl-tRNA amidotransferase subunit B | TPR domain protein | methyl-accepting chemotaxis protein | sensory box histidine kinase/response regulator | sigma-54 dependent DNA-binding response regulator | CRISPR-associated helicase Cas3 domain protein |
203 | 11 | 367 | -47.878 | 0.441 | Residual = 0.441 | | CGcCGtaTGCC | AcgcatCCgtTAACtTtA | | DVU1385 DVU1431 DVU1836 DVU2062 DVU2218 DVU2295 DVU2424 DVU2517 DVU2906 DVU3132 DVU3142 | umuC | hypothetical protein | hpt domain protein/STAS domain protein | tRNA nucleotidyltransferase, putative | ATP-dependent DNA helicase, UvrD/REP family | GTP-binding protein, putative | methyl-accepting chemotaxis protein | umuC protein | glycerol-3-phosphate dehydrogenase, FAD-dependent | sigma-54 dependent transcriptional regulator |
204 | 18 | 371 | -58.160 | 0.415 | Residual = 0.415 | | GGAATC | TCAgCggaCGGGG | | DVU0189 DVU0197 DVU0202 DVU0203 DVU0206 DVU0209 DVU0210 DVU0211 DVU0212 DVU2857 DVU2858 DVU2859 DVU2861 DVU2862 DVU2863 DVU2864 DVU2866 DVU2867 | | phage/plasmid primase, P4 family | phage portal protein, lambda family | holin | hypothetical protein | tail sheath protein, putative | tail tube protein, putative |
205 | 17 | 362 | -31.268 | 0.516 | Residual = 0.516 | | AAAcAAtaATgTcgAAcCAAAAAA | CATCcCCCATC | | DVU0050 DVU0053 DVU0145 DVU0361 DVU0416 DVU0476 DVU0542 DVU0544 DVU0614 DVU0639 DVU1384 DVU2775 DVU2781 DVU3082 DVU3140 DVU3265 DVU3286 | motA-1 pomB pyrR | chemotaxis protein MotA | sulfate permease, putative | response regulator | acetolactate synthase 1 regulatory subunit | GGDEF domain protein | hypothetical protein | universal stress protein family | chemotaxis protein PomB | pyrimidine regulatory protein PyrR | methyl-accepting chemotaxis protein | capsular polysaccharide transport protein, putative | tartrate dehydratase beta subunit, putative |
206 | 33 | 376 | -25.285 | 0.577 | Residual = 0.577 | | AAAActttAtgTTGcCATatgcAa | CACgTAAAAGG | | DVU0012 DVU0021 DVU0097 DVU0121 DVU0122 DVU0123 DVU0124 DVU0335 DVU0460 DVU0461 DVU0462 DVU0463 DVU0464 DVU0465 DVU0466 DVU0467 DVU0468 DVU0469 DVU0470 DVU0471 DVU0480 DVU0606 DVU0607 DVU0997 DVU1028 DVU1065 DVU1847 DVU2252 DVU2448 DVU2449 DVU2930 DVU3046 DVU3193 | potB aroA trpG trpD trpC trpF-1 trpB-2 trpA ahcY metF cmk dnaA-2 panC metK | hypothetical protein | polyamine ABC transporter, permease protein | 3-deoxy-D-manno-octulosonic-acid transferase, putative | fructose-bisphosphate aldolase | 3-dehydroquinate synthase | chorismate mutase/prephenate dehydratase | 3-phosphoshikimate 1-carboxyvinyltransferase | prephenate dehydrogenase | anthranilate synthase, component I | anthranilate synthase, glutamine amidotransferase component | anthranilate phosphoribosyltransferase | indole-3-glycerol phosphate synthase | N-(5'-phosphoribosyl)anthranilate isomerase | tryptophan synthase subunit beta | tryptophan synthase subunit alpha | transcriptional regulator, ArsR family/methyltransferase, UbiE/COQ5 family | S-adenosyl-L-homocysteine hydrolase | 5,10-methylenetetrahydrofolate reductase | cytidylate kinase | peptidyl-prolyl cis-trans isomerse domain protein | chromosomal replication initiator protein DnaA | pantoate--beta-alanine ligase | S-adenosylmethionine synthetase | glycosyl transferase, group 1 family protein | DNA-binding domain, excisionase family |
207 | 14 | 367 | -60.140 | 0.369 | Residual = 0.369 | |
|
| | DVU2286 DVU2288 DVU2289 DVU2290 DVU2291 DVU2292 DVU2293 DVU3024 DVU3025 DVU3027 DVU3029 DVU3030 DVU3031 DVU3032 | hypA cooF poR glcD pta ackA | hydrogenase, CooM subunit, putative | hydrogenase, CooL subunit, putative | hydrogenase, CooX subunit, putative | hydrogenase, CooU subunit, putative | carbon monoxide-induced hydrogenase CooH, putative | hydrogenase nickel insertion protein HypA | iron-sulfur protein CooF | hypothetical protein | pyruvate-ferredoxin oxidoreductase | glycolate oxidase, subunit GlcD | phosphate acetyltransferase | acetate kinase |
208 | 17 | 361 | -32.244 | 0.505 | Residual = 0.505 | | AAGGAGGC | TCTtctTnncAgACaggCAgacCa | | DVU0018 DVU0422 DVU0522 DVU0861 DVU1032 DVU1096 DVU1117 DVU1938 DVU1987 DVU2039 DVU2063 DVU2064 DVU2069 DVU2135 DVU2579 DVU2774 DVU3276 | argF uvrA | methyl-accepting chemotaxis protein, putative | sensory box/GGDEF domain/EAL domain protein | flagellar assembly protein FliW | glycosyl transferase, group 1 family protein | hypothetical protein | ornithine carbamoyltransferase | excinuclease ABC, A subunit | oxidoreductase, 2-nitropropane dioxygenase family | DNA processing protein DprA, putative | TPR domain protein | CBS domain protein/ACT domain protein | ferredoxin I |
209 | 13 | 370 | -86.245 | 0.319 | Residual = 0.319 | | aTGaCaAG | GtCTTAtCttAaAGGcAGA | | DVU0572 DVU0576 DVU0665 DVU0813 DVU1457 DVU1601 DVU1875 DVU1876 DVU1984 DVU2086 DVU2325 DVU2497 DVU2893 | msrB hrcA msrA merP | hypothetical protein | methionine sulfoxide reductase B | nitrogen fixation protein nifU | heat-inducible transcription repressor HrcA | thioredoxin reductase, putative | ATP-dependent Clp protease adaptor protein ClpS | dafA protein | dnaJ protein, putative | peptide methionine sulfoxide reductase MsrA | transcriptional regulator, GntR family | mercuric transport protein periplasmic component | lipoprotein, putative | flagellar basal-body rod protein, putative |
210 | 11 | 373 | -80.811 | 0.336 | Residual = 0.336 | | ACaACA | TTaTCtTGgCCTcCCTCgGCA | | DVU0365 DVU0366 DVU1152 DVU1710 DVU1829 DVU2161 DVU2266 DVU2578 DVU2599 DVU2637 DVU2786 | | hypothetical protein | 5-formyltetrahydrofolate cyclo-ligase family protein | response regulator | HAMP domain protein |
211 | 31 | 363 | -24.813 | 0.535 | Residual = 0.535 | | tGccgTGnCTGaCg | aGGGCATCCGTCccG | | DVU0031 DVU0032 DVU0393 DVU0647 DVU0655 DVU0757 DVU0814 DVU0978 DVU0982 DVU1188 DVU1401 DVU1437 DVU1445 DVU1938 DVU2419 DVU2477 DVU2479 DVU2822 DVU2824 DVU3014 DVU3073 DVU3209 DVU3219 DVU3223 DVU3284 DVU3360 DVU3361 DVUA0086 DVUA0097 DVUA0114 DVUA0117 | ung pstS aspB escJ | AzlC family protein | hypothetical protein | uracil-DNA glycosylase | iron compound ABC transporter, periplasmic iron compount-binding protein, putative | PHP domain protein | bacterioferritin comigratory protein, putative | ABC transporter, periplasmic substrate-binding protein, putative | flagellar hook-length control domain protein | phosphate ABC transporter, periplasmic phosphate-binding protein PstS | phosphate ABC transporter, permease protein, putative | TRAP transporter solute receptor DctP | formate acetyltransferase | asparagine synthetase, glutamine-hydrolyzing | aspartate aminotransferase | L-lactate permease | ParB family protein | ADP-heptose synthase, putative | response regulator | radical SAM domain protein | type III secretion lipoprotein |
212 | 10 | 367 | -69.578 | 0.344 | Residual = 0.344 | |
|
| | DVU1302 DVU1304 DVU1305 DVU1306 DVU1307 DVU1313 DVU1315 DVU1321 DVU1322 DVU1324 | rpsJ rplD rplW rplB rpsS rplN rplE rpmD rplO map | 30S ribosomal protein S10 | 50S ribosomal protein L4 | 50S ribosomal protein L23 | 50S ribosomal protein L2 | 30S ribosomal protein S19 | 50S ribosomal protein L14 | 50S ribosomal protein L5 | 50S ribosomal protein L30 | 50S ribosomal protein L15 | methionine aminopeptidase, type I |
213 | 13 | 370 | -55.343 | 0.388 | Residual = 0.388 | | TTTTtTAtTAT | TgcTGtatgCcGTGT | | DVU0039 DVU0183 DVU1103 DVU1713 DVU2217 DVU2559 DVU2604 DVU2689 DVU2731 DVU2830 DVU3338 DVU3339 DVUA0030 | bioA kdpB kdpA | C4-type zinc finger protein, DksA/TraR family | methyl-accepting chemotaxis protein | baseplate assembly protein, putative | hypothetical protein | acetyltransferase, GNAT family | adenosylmethionine--8-amino-7-oxononanoate aminotransferase | bacteriophage DNA transposition B protein | tail fiber assembly protein, putative | K+-transporting ATPase, B subunit | potassium-transporting ATPase subunit A |
214 | 27 | 359 | -29.100 | 0.510 | Residual = 0.510 | | AAcacaCaACAgGAtAgGaA | CGCAngAGGCATGAC | | DVU0229 DVU0297 DVU0372 DVU0405 DVU0546 DVU0620 DVU0652 DVU0666 DVU0940 DVU1739 DVU1825 DVU1860 DVU1989 DVU2257 DVU2391 DVU2478 DVU2584 DVU2666 DVU2761 DVU2825 DVU2843 DVU2844 DVU3023 DVU3145 DVU3147 DVU3195 DVU3196 | cobB-1 cheV-2 lnt pstC | hypothetical protein | cobyrinic acid a,c-diamide synthase | endoribonuclease, L-PSP family | chemotaxis protein CheV | HD domain protein | GGDEF domain protein | amidohydrolase family protein | apolipoprotein N-acyltransferase | phosphate ABC transporter, permease protein PstC | transporter, CorA family | phosphate ABC transporter, permease protein, putative | pyruvate formate-lyase 1 activating enzyme, putative | DNA mismatch endonuclease Vsr, putative | sigma-54 dependent DNA-binding response regulator | hydrogenase, b-type cytochrome subunit, putative | 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase | lipoprotein, putative | twin-arginine translocation pathway signal sequence domain protein |
215 | 30 | 368 | -27.465 | 0.554 | Residual = 0.554 | | GtATAGattaAaTnTaTnntT | TnTTgAcaaTnATntGtgaTgA | | DVU0023 DVU0225 DVU0702 DVU0715 DVU0716 DVU0745 DVU0832 DVU0965 DVU1006 DVU1177 DVU1225 DVU1232 DVU1354 DVU1578 DVU1588 DVU1669 DVU1708 DVU1709 DVU1873 DVU1877 DVU2206 DVU2235 DVU2308 DVU2527 DVU2657 DVU2658 DVU2659 DVU2778 DVU2940 DVU2941 | glnB-1 hpt rluB hsdM ppiB-2 | hypothetical protein | cytochrome c family protein | branched-chain amino acid ABC transporter, ATP binding protein | branched-chain amino acid ABC transporter, ATP-binding protein | ABC transporter, periplasmic substrate-binding protein | tetrapyrrole methylase family protein | nitrogen regulatory protein P-II | TPR domain protein | hypoxanthine phosphoribosyltransferase | ribosomal large subunit pseudouridine synthase B | type I restriction-modification system, M subunit | peptidyl-prolyl cis-trans isomerase B | polysaccharide deacetylase family protein | conserved hypothetical protein TIGR00022 | transcriptional regulator, putative | 6-pyruvoyl tetrahydrobiopterin synthase, putative | exsB protein |
216 | 21 | 369 | -30.318 | 0.600 | Residual = 0.600 | | atATcAgnAAtngTTnnTgt | aTnTcCTTtCgntgtttcAA | | DVU0024 DVU0033 DVU0606 DVU0607 DVU0772 DVU0924 DVU0943 DVU0997 DVU1170 DVU1228 DVU2241 DVU2247 DVU2248 DVU2318 DVU2407 DVU3093 DVU3094 DVU3095 DVU3188 DVU3270 DVU3271 | ahcY rumA metF tpX pdxA rdl rr cydB cydA | hypothetical protein | isochorismatase family protein | transcriptional regulator, ArsR family/methyltransferase, UbiE/COQ5 family | S-adenosyl-L-homocysteine hydrolase | 23S rRNA (uracil-5-)-methyltransferase RumA | 5,10-methylenetetrahydrofolate reductase | thiol peroxidase | pyridoxal phosphate biosynthetic protein PdxA | antioxidant, AhpC/Tsa family | rubrerythrin, putative | rubredoxin-like protein | rubrerythrin | transcriptional regulator, Fur family | NLP/P60 family protein | cytochrome d ubiquinol oxidase, subunit II | cytochrome d ubiquinol oxidase, subunit I |
217 | 12 | 368 | -83.573 | 0.344 | Residual = 0.344 | | aAGCaCAaAA | TAtaattcaanaTTGGcAngTT | | DVU0389 DVU0658 DVU0675 DVU1234 DVU2057 DVU2070 DVU2084 DVU2094 DVU2153 DVU2155 DVU2169 DVU3354 | thiG | amino acid ABC tranporter, permease protein, His/Glu/Gln/Arg/opine family | heat shock protein, Hsp20 family | amino acid ABC transporter, periplasmic amino acid-binding protein | hypothetical protein | TPR domain protein | oligopeptide-binding protein, putative | thiazole synthase | tail fiber protein, putative |
218 | 13 | 366 | -72.271 | 0.346 | Residual = 0.346 | | CATTaCGAAGCAagAAaGAAC | TtATtATATT | | DVU0663 DVU0665 DVU0811 DVU0812 DVU0825 DVU0857 DVU0994 DVU1468 DVU1976 DVU1977 DVU2078 DVU2079 DVU2643 | cysK dnaK grpE secA groEL groES cheB-2 htpG | cysteine synthase A | nitrogen fixation protein nifU | dnaK protein | heat shock protein GrpE | preprotein translocase subunit SecA | radical SAM domain protein | hypothetical protein | peptidase/PDZ domain protein | chaperonin GroEL | chaperonin, 10 kDa | protein-glutamate methylesterase CheB | sensory box histidine kinase | heat shock protein 90 |
219 | 23 | 367 | -38.246 | 0.487 | Residual = 0.487 | | aAaGcttgCagACattgTGCttT | AAAnaAtCTtT | | DVU0695 DVU0781 DVU0782 DVU0783 DVU1082 DVU1393 DVU1678 DVU1859 DVU1964 DVU1965 DVU1966 DVU2017 DVU2066 DVU2067 DVU2265 DVU2648 DVU2651 DVU2652 DVU2653 DVU2917 DVU2919 DVU3138 DVU3146 | rimI lpxC | hypothetical protein | 3'- 5' exonuclease domain protein | ribosomal-protein-alanine acetyltransferase | transcriptional regulator, rrf2 protein, putative | ISDvu5, transposase | site-specific recombinase, phage integrase family | GGDEF domain protein | UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase |
220 | 23 | 367 | -59.512 | 0.456 | Residual = 0.456 | | CTATgccTTttCgTTGcT | GcCcgCGTGcgGCnT | | DVU1094 DVU1095 DVU1653 DVU1913 DVU2001 DVU3024 DVU3025 DVU3026 DVU3027 DVU3028 DVU3029 DVU3030 DVU3031 DVU3032 DVU3033 DVU3197 DVU3199 DVU3200 DVU3235 DVU3347 DVU3348 DVU3349 DVU3350 | argH argG poR glcD pta ackA ilvE recR | argininosuccinate lyase | argininosuccinate synthase | polyA polymerase family protein | aspartate kinase, monofunctional class | hypothetical protein | pyruvate-ferredoxin oxidoreductase | L-lactate permease family protein | glycolate oxidase, subunit GlcD | iron-sulfur cluster-binding protein | phosphate acetyltransferase | acetate kinase | branched-chain amino acid aminotransferase | conserved hypothetical protein TIGR00103 | recombination protein RecR | IMP cyclohydrolase, putative | pyruvate ferredoxin/flavodoxin oxidoreductase family protein | pyruvate ferredoxin/flavodoxin oxidoreductase, beta subunit, putative | 2-ketoisovalerate ferredoxin reductase |
221 | 19 | 360 | -31.738 | 0.586 | Residual = 0.586 | | CGCcAAtGATGTTgtgTTaAT | CAngncAgGgcAAGGcaGG | | DVU0107 DVU0501 DVU0642 DVU1066 DVU1067 DVU1069 DVU1070 DVU1271 DVU1272 DVU1275 DVU1323 DVU1742 DVU2355 DVU2356 DVU2930 DVU3051 DVU3052 DVU3055 DVU3103 | glnH gpt secY trmH mutT | glutamine ABC transporter, periplasmic glutamine-binding protein | hypothetical protein | hydrolase, alpha/beta fold family | xanthine-guanine phosphoribosyltransferase | membrane protein, Bmp family | branched chain amino acid ABC transporter, permease protein | branched chain amino acid ABC transporter, ATP-binding protein | general secretion pathway protein F, putative | general secretion pathway protein E, putative | preprotein translocase subunit SecY | prevent-host-death family protein | tRNA (guanosine-2'-O-)-methyltransferase | mutator mutT protein | ABC transporter, ATP-binding protein | ribonuclease, Rne/Rng family | tolB protein, putative |
222 | 22 | 365 | -33.116 | 0.568 | Residual = 0.568 | | AataGACgTATaTGgAcTagTGcA | ActCcTCcGtAaaTcTGCccG | | DVU0049 DVU0131 DVU0132 DVU0133 DVU0195 DVU0288 DVU0355 DVU0452 DVU0623 DVU0644 DVU1838 DVU2825 DVU2884 DVU2992 DVU3064 DVU3106 DVU3321 DVU3322 DVU3323 DVU3324 DVU3386 DVUA0029 | trxB-2 | OmpA family protein | hypothetical protein | sensory box/GGDEF domain protein | thioredoxin-disulfide reductase | pyruvate formate-lyase 1 activating enzyme, putative | putative aminopeptidase 1 | glycosyl transferase, group 2 family protein | sensory box/GGDEF domain/EAL domain protein | GGDEF domain protein | ABC transporter, permease protein | ABC transporter, ATP-binding protein | permease, putative |
223 | 28 | 371 | -30.893 | 0.488 | Residual = 0.488 | | GGgcgCAaGGC | GGCATcGtATCGACGcagCAC | | DVU0135 DVU0136 DVU0141 DVU0323 DVU0414 DVU0660 DVU0724 DVU0726 DVU0795 DVU0796 DVU1029 DVU1060 DVU1091 DVU1220 DVU1540 DVU1693 DVU1827 DVU1942 DVU1978 DVU2055 DVU2210 DVU2436 DVU2471 DVU2493 DVU2552 DVU2892 DVU3208 DVU3389 | folD tgt purC hisD hisC purU gltX-1 metG gltX-2 topA | hypothetical protein | peptidase, M50 family | methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase | NADP-dependent malic enzyme-related protein | phosphodiesterase | sodium/alanine symporter family protein | queuine tRNA-ribosyltransferase | phosphoribosylaminoimidazole-succinocarboxamide synthase | histidinol dehydrogenase | histidinol-phosphate aminotransferase | glycosyl transferase, group 1 family protein | nitroreductase family protein | formyltetrahydrofolate deformylase | glutamyl-tRNA synthetase | succinyl-diaminopimelate desuccinylase | DAK2 domain/degV family protein | Na+/H+ antiporter family protein | methionyl-tRNA synthetase | TPR domain protein | oxidoreductase, selenocysteine-containing | iron-sulfur cluster-binding protein | DNA topoisomerase I |
224 | 16 | 366 | -17.750 | 0.597 | Residual = 0.597 | | ACAGGATGnGC | AAaTTGTTGAA | | DVU0015 DVU1031 DVU1221 DVU1222 DVU1226 DVU1229 DVU1711 DVU1988 DVU1992 DVU1994 DVU2219 DVU2221 DVU2411 DVU2527 DVU3098 DVU3141 | lgt | prolipoprotein diacylglyceryl transferase | hypothetical protein | antibiotic acetyltransferase | EF hand domain protein | transcriptional regulator, putative | lipoprotein, putative |
225 | 25 | 359 | -18.589 | 0.575 | Residual = 0.575 | | AaccTaacGnAaAaAata | AgGcAGAG | | DVU0178 DVU0228 DVU0537 DVU0641 DVU0798 DVU0800 DVU0955 DVU0962 DVU1016 DVU1388 DVU1402 DVU1418 DVU1507 DVU1566 DVU2058 DVU2059 DVU2091 DVU2528 DVU2587 DVU2625 DVU2746 DVU2810 DVU2826 DVU2969 DVU3288 | alr thiE-1 | hypothetical protein | alanine racemase | transcriptional regulator, LysR family | sensory box histidine kinase | phosphoadenosine phosphosulfate reductase, putative | HDIG domain protein | glycosyl transferase, group 2 family protein | thiamine-phosphate pyrophosphorylase | sensor histidine kinase | formate dehydrogenase formation protein FdhE, putative | acetoacetyl-CoA synthase |
226 | 29 | 366 | -25.035 | 0.529 | Residual = 0.529 | | ATgGTCaAACaAAAA | ACAGGACGCaT | | DVU0359 DVU0389 DVU0574 DVU0575 DVU0832 DVU0854 DVU0866 DVU1380 DVU1381 DVU1382 DVU1567 DVU1577 DVU1578 DVU1644 DVU1645 DVU1680 DVU1745 DVU1943 DVU1975 DVU1985 DVU2333 DVU2621 DVU2662 DVU2785 DVU2941 DVU3242 DVU3245 DVU3357 DVU3358 | dxr hslV suhB ndk rpoZ greA | HesB-like domain | amino acid ABC tranporter, permease protein, His/Glu/Gln/Arg/opine family | hypothetical protein | tetrapyrrole methylase family protein | NirD protein, putative | 1-deoxy-D-xylulose 5-phosphate reductoisomerase | HesB family selenoprotein | ATP-dependent protease peptidase subunit | TPR domain protein | permease, putative | transcriptional regulator, ArsR family | inositol-1-monophosphatase | DNA-binding protein | methyl-accepting chemotaxis protein | nucleoside diphosphate kinase | transcriptional regulator, GntR family | DNA-directed RNA polymerase, omega subunit | transcription elongation factor GreA | ParA family protein |
227 | 22 | 365 | -39.443 | 0.456 | Residual = 0.456 | | CTGCTGaCGagG | ATCaTCGcctT | | DVU0525 DVU0759 DVU0825 DVU0856 DVU0864 DVU0865 DVU1191 DVU1193 DVU1267 DVU1432 DVU1467 DVU1788 DVU1789 DVU1855 DVU2363 DVU2487 DVU2488 DVU2554 DVU3243 DVU3315 DVU3365 DVU3366 | secA hemB radC hslU rpoD dnaG thiM dnaJ pyrK fmt def | transcriptional regulator, MarR family | peptidase, M29 family | preprotein translocase subunit SecA | delta-aminolevulinic acid dehydratase | glycoprotease family protein, putative | membrane-associated zinc metalloprotease, putative | ATP-dependent protease La, putative | DNA repair protein RadC | hypothetical protein | radical SAM domain protein | ATP-dependent protease ATP-binding subunit | RNA polymerase sigma-70 factor | DNA primase | integrase, truncation | hydroxyethylthiazole kinase | dnaJ protein | dihydroorotate dehydrogenase, electron transfer subunit | methionyl-tRNA formyltransferase | polypeptide deformylase |
228 | 24 | 363 | -29.123 | 0.510 | Residual = 0.510 | | ATGAaAaG | tTGCGTgTCAAtgAA | | DVU0114 DVU0282 DVU0671 DVU1061 DVU1176 DVU1223 DVU1225 DVU1236 DVU1394 DVU1539 DVU1660 DVU1807 DVU1942 DVU2113 DVU2254 DVU2255 DVU2259 DVU2260 DVU2376 DVU2521 DVU3053 DVU3059 DVU3090 DVU3389 | hisG mutY glpX nadC thyX ruvB rrmJ lysS aroK ftsY topA | ATP phosphoribosyltransferase | A/G-specific adenine glycosylase | hypothetical protein | glycosyl transferase, group 1 family protein | amino acid ABC transporter, ATP-binding protein | fructose 1,6-bisphosphatase II | undecaprenol kinase, putative | nicotinate-nucleotide pyrophosphorylase | DAK2 domain/degV family protein | xanthine/uracil permease family protein | FAD-dependent thymidylate synthase | Holliday junction DNA helicase B | ribosomal RNA large subunit methyltransferase J | lysyl-tRNA synthetase | shikimate kinase | signal recognition particle-docking protein FtsY | outer membrane protein, OMPP1/FadL/TodX family | DNA topoisomerase I |
229 | 31 | 371 | -34.505 | 0.520 | Residual = 0.520 | | GTgTgTgcGTGGTAgGATGA | CcATaTCCgTTGaCttgcgTg | | DVU0322 DVU0407 DVU0627 DVU0682 DVU0790 DVU1405 DVU1780 DVU1781 DVU1782 DVU1783 DVU1784 DVU1785 DVU1862 DVU1901 DVU1916 DVU1921 DVU1922 DVU1923 DVU1924 DVU1925 DVU2013 DVU2014 DVU2021 DVU2353 DVU2416 DVU2460 DVU2675 DVU2770 DVU2937 DVU3035 DVU3049 | eno ptB hynB-1 hynA-1 hupD hypC | enolase | rare lipoprotein A family protein | phosphotransbutyrylase | DNA-binding protein, putative | radical SAM protein, TIGR01212 family | hypothetical protein | iron-sulfur cluster-binding protein | cysteine-rich domain protein | oxidoreductase, short-chain dehydrogenase/reductase family | membrane protein, MarC family | GGDEF domain protein | peptidyl-prolyl cis-trans isomerase domain protein | periplasmic [NiFe] hydrogenase, small subunit, isozyme 1 | periplasmic [NiFe] hydrogenase, large subunit, isozyme 1 | hydrogenase expression/formation protein HupD | hydrogenase assembly chaperone hypC/hupF | lipase, GDSL family | hydroxylamine reductase | metallo-beta-lactamase family protein | glycosyl transferase, group 2 family protein | DNA-binding response regulator, LuxR family | response regulator | TPR domain protein/response regulator receiver domain protein | methyl-accepting chemotaxis protein, putative | hemerythrin family protein |
230 | 25 | 367 | -26.277 | 0.584 | Residual = 0.584 | | AaaaTCAATAtcACatcCTTTTCA | TACcgGtgACGGCAnntGgCA | | DVU0113 DVU0335 DVU0477 DVU0671 DVU0672 DVU0704 DVU0745 DVU0953 DVU1054 DVU1186 DVU1223 DVU1453 DVU1469 DVU1677 DVU2263 DVU2433 DVU2434 DVU2521 DVU2586 DVU2644 DVU2946 DVU3118 DVU3119 DVU3253 DVU3299 | hisI icd lepB tyrS mazG fadD rpsA tpiA aroK | phosphoribosyl-AMP cyclohydrolase | 3-deoxy-D-manno-octulosonic-acid transferase, putative | isocitrate dehydrogenase, NADP-dependent | hypothetical protein | signal peptidase I | ABC transporter, periplasmic substrate-binding protein | tyrosyl-tRNA synthetase | hydrolase, HAD-superfamily, subfamily IIIA | nucleoside triphosphate pyrophosphohydrolase | long-chain-fatty-acid--CoA ligase | 30S ribosomal protein S1 | triosephosphate isomerase | outer membrane autotransporter barrel domain protein | shikimate kinase | putative ABC transporter ATP-binding protein | transcriptional regulator, GntR family | AMP-binding enzyme family protein | phenylacetate-coenzyme A ligase, putative |
231 | 19 | 368 | -49.417 | 0.459 | Residual = 0.459 | | TgcAAgCgtcAGGAGGCTTT | TAcTAgCCACTGAACCCCTTCaA | | DVU1116 DVU1117 DVU1118 DVU1120 DVU1128 DVU1129 DVU1131 DVU1135 DVU1136 DVU1139 DVU1141 DVU1142 DVU1143 DVU2688 DVU2698 DVU2699 DVU2711 DVU2712 DVU2714 | | hypothetical protein | lysozyme, putative | host-nuclease inhibitor protein Gam, putative | bacteriophage DNA transposition B protein, putative | transcriptional regulator, putative | bacteriophage transposase A protein | lipoprotein, putative | transglycosylase SLT domain protein | major head subunit, putative |
232 | 22 | 368 | -46.450 | 0.493 | Residual = 0.493 | | TAacACGGgGaAAcAGGAGAaTC | CGatAtnGGTTtTcA | | DVU0302 DVU0837 DVU0838 DVU0936 DVU0942 DVU0986 DVU0987 DVU1093 DVU1190 DVU1367 DVU1372 DVU1373 DVU1374 DVU1375 DVU1377 DVU1378 DVU1392 DVU1612 DVU1834 DVU2532 DVU2965 DVU3187 | rimM divIVA ilvN-2 ilvC hup-4 | chemotaxis protein CheX, putative | 16S rRNA processing protein RimM | hypothetical protein | transcriptional regulator, Fur family | heavy metal-binding domain protein | HAD-superfamily hydrolase, subfamily IA, variant 3 | sensory box/GGDEF domain/EAL domain protein | twin-arginine translocation protein, TatA/E family | cell-division initiation protein DivIVA | acetolactate synthase, small subunit | ketol-acid reductoisomerase | NLP/P60 family protein | ACT domain protein | pyruvate carboxylase | transcriptional regulator, MerR family | DNA-binding protein HU |
233 | 22 | 372 | -44.189 | 0.486 | Residual = 0.486 | | cTgcagTAtTTGCaATAcCtA | AggAATctCCcCnTTgCgtta | | DVU0570 DVU0618 DVU1427 DVU1477 DVU1478 DVU1480 DVU1520 DVU1521 DVU1705 DVU1706 DVU1711 DVU1734 DVU1745 DVU2178 DVU2180 DVU2709 DVU2717 DVU2718 DVUA0018 DVUA0019 DVUA0020 DVUA0026 | | hypothetical protein | response regulator | type I restriction-modification enzyme, S subunit | DNA-binding protein | ISDvu2, transposase OrfB | type II DNA modification methyltransferase, putative | type II restriction endonuclease, putative |
234 | 21 | 353 | -51.246 | 0.410 | Residual = 0.410 | | ATATTCggTGTCcAAtggCATT | AGGTATgTAgTaaAATAGTAT | | DVU0070 DVU0351 DVU1035 DVU1239 DVU1508 DVU1858 DVU2283 DVU2336 DVU2456 DVU2517 DVU2628 DVU2755 DVU2874 DVU3110 DVU3211 DVU3325 DVUA0043 DVUA0055 DVUA0096 DVUA0139 DVUA0140 | | Ser/Thr protein phosphatase family protein | cytidine 5'monophosphate N-acetylneuraminic acid synthetase, putative/polysaccharide biosynthesis protein | glucokinase, putative | hypothetical protein | cold shock domain protein | carboxyl-terminal protease | TPR domain protein | polysaccharide deacetylase family protein | major facilitator superfamily protein | outer membrane autotransporter barrel domain protein |
235 | 25 | 373 | -31.047 | 0.488 | Residual = 0.488 | | CtcTTcCcnT | AAAAAG | | DVU0399 DVU0503 DVU0507 DVU0508 DVU0510 DVU0753 DVU0809 DVU0810 DVU1247 DVU1248 DVU1298 DVU1299 DVU1300 DVU1571 DVU1622 DVU2216 DVU2298 DVU2299 DVU2913 DVU2914 DVU3116 DVU3206 DVU3307 DVU3308 DVU3310 | pnp infB nusA gatC argS rpsL rpsG fusA-1 rho purQ infA-2 prfA prfC ubiX | hypothetical protein | polynucleotide phosphorylase/polyadenylase | translation initiation factor IF-2 | transcription elongation factor NusA | amino acid ABC transporter, ATP-binding protein | glutamyl-tRNA(Gln) amidotransferase, C subunit | arginyl-tRNA synthetase | 30S ribosomal protein S12 | 30S ribosomal protein S7 | elongation factor G | transcription termination factor Rho | phosphoribosylformylglycinamidine synthase I | translation initiation factor IF-1 | glycine/betaine/L-proline ABC transporter, permease protein | glycine/betaine/L-proline ABC transporter, ATP binding protein | lipoprotein, putative | peptide chain release factor 1 | peptide chain release factor 3 | phosphoribosylaminoimidazolecarboxamide formyltransferase, putative | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase | metallo-beta-lactamase family protein | ATP-dependent RNA helicase, DEAD/DEAH family |
236 | 31 | 368 | -18.199 | 0.594 | Residual = 0.594 | | AgTcaTcnCATTtTT | CAtcACtggaGgAA | | DVU0090 DVU0274 DVU0290 DVU0322 DVU0378 DVU0398 DVU0418 DVU0761 DVU0870 DVU1072 DVU1368 DVU1412 DVU1613 DVU1868 DVU1886 DVU1980 DVU2082 DVU2108 DVU2109 DVU2112 DVU2143 DVU2203 DVU2313 DVU2420 DVU2460 DVU2490 DVU2735 DVU2769 DVU3212 DVU3351 DVU3352 | wcaG eno lys1 frr dapA fba pgl paaK-3 queA | GDP-fucose synthetase | hypothetical protein | lipoprotein, putative | enolase | thioredoxin, putative | HMGL-like domain protein | saccharopine dehydrogenase | ribosome recycling factor | rhodanese-like domain protein | glycerate dehydrogenase | putative glutamate synthase subunit beta | dihydrodipicolinate synthase | flagellin, putative | fructose-1,6-bisphosphate aldolase, class II | endoribonuclease, L-PSP family | 6-phosphogluconolactonase | histidinol phosphatase, putative | phenylacetate-coenzyme A ligase | pyridine nucleotide-disulfide oxidoreductase | S-adenosylmethionine:tRNA ribosyltransferase-isomerase |
237 | 13 | 369 | -67.264 | 0.357 | Residual = 0.357 | | AAAtGCacaC | AAATTgATtT | | DVU0388 DVU1075 DVU1076 DVU1077 DVU1587 DVU1626 DVU1818 DVU1819 DVU1840 DVU1929 DVU2374 DVU2922 DVU3069 | rnpA secF secD lolD secE | amino acid ABC transporter, ATP-binding protein | ribonuclease P protein component | conserved hypothetical protein TIGR00278 | inner membrane protein, 60 kDa | acetyltransferase | hypothetical protein | preprotein translocase subunit SecF | preprotein translocase subunit SecD | metalloendopeptidase, putative, glycoprotease family | lipoprotein releasing system, ATP-binding protein | preprotein translocase subunit SecE | conserved hypothetical protein TIGR00247 |
238 | 24 | 365 | -24.426 | 0.572 | Residual = 0.572 | | GcGCGAggTGTGCcggGccatGTG | GgATGccgTcT | | DVU0010 DVU0011 DVU0171 DVU0188 DVU0406 DVU0435 DVU0437 DVU0457 DVU0568 DVU1216 DVU1253 DVU1421 DVU2081 DVU2093 DVU2242 DVU2321 DVU2610 DVU2629 DVU2918 DVU3063 DVU3256 DVU3376 DVU3377 DVU3394 | thiH mviN-2 mutM dgkA | TRAP transporter, DctQ subunit | TRAP transporter solute receptor DctP | hemolysin-related protein | hypothetical protein | efflux transporter, RND family, MFP subunit | EAL domain protein | tRNA 2-selenouridine synthase | thiamine biosynthesis protein ThiH | asparaginase family protein | integral membrane protein MviN | formamidopyrimidine-DNA glycosylase | sulfatase family protein | diacylglycerol kinase |
239 | 24 | 368 | -26.230 | 0.557 | Residual = 0.557 | | actgAatctCTtCCATaTcgaTgC | TaTcaAAAGgAAgc | | DVU0013 DVU0287 DVU1085 DVU1108 DVU1110 DVU1474 DVU1476 DVU1481 DVU1512 DVU1659 DVU1700 DVU1701 DVU1734 DVU1749 DVU1751 DVU1975 DVU2184 DVU2606 DVU2707 DVU2708 DVU2716 DVU2728 DVU2841 DVU3340 | phoU | sensory box histidine kinase | hypothetical protein | phosphate transport system protein PhoU | nuclease domain protein | metallo-beta-lactamase family protein | methyl-accepting chemotaxis protein | DNA-binding domain, excisionase family | virion morphogenesis protein | tail sheath protein, putative | tail protein, putative | type II restriction endonuclease, putative |
240 | 1 | 359 | -137.244 | 1.000 | Residual = 1.000 | |
|
| | DVU0710 | | competence protein comM, putative |
241 | 19 | 369 | -61.713 | 0.398 | Residual = 0.398 | | agaaTATaATt | GgntcctGGccTGcAaCGTGgCa | | DVU0170 DVU0174 DVU0729 DVU0820 DVU0821 DVU0822 DVU1263 DVU1774 DVU1811 DVU1813 DVU1814 DVU2304 DVU2345 DVU2585 DVU2615 DVU2676 DVU2833 DVU3155 DVUA0025 | pppA dcrH | methyl-accepting chemotaxis protein | hypothetical protein | type IV prepilin-like proteins leader peptidase | protoheme IX farnesyltransferase, putative | cytochrome c oxidase, subunit III, putative | bacterial extracellular solute-binding protein, family 3 | methyl-accepting chemotaxis protein DcrH | response regulator receiver domain protein |
242 | 17 | 364 | -75.711 | 0.542 | Residual = 0.542 | | aAtTCTcTGcATaAGaaAaAtAAT | ATTattTCCaTCgCAtGGGaA | | DVU1162 DVU1414 DVU1550 DVU1551 DVU1552 DVU1553 DVU1554 DVU1555 DVU1556 DVU1557 DVU1558 DVU1559 DVU1560 DVU1561 DVU1753 DVU2773 DVU2774 | mop | hypothetical protein | sensory box/GGDEF domain/EAL domain protein | phosphoglycerate mutase family protein | HD domain protein | AMP-binding protein | radical SAM domain protein | cysteine-rich domain/iron-sulfur cluster-binding domain protein | aldehyde oxidoreductase | molybdopterin biosynthesis protein, putative | molybdenum-binding protein, HTH domain | CBS domain protein/ACT domain protein |
243 | 11 | 367 | -99.941 | 0.322 | Residual = 0.322 | | GcTaCTgTCATCATCgtgaTcAcT | TtGAAcGncaAgAncgtTgCaaA | | DVU1059 DVU1063 DVU1700 DVU1707 DVU1733 DVU1747 DVU1996 DVU2122 DVU2186 DVU2207 DVU2262 | | aminotransferase, putative | transcriptional regulatory protein | metallo-beta-lactamase family protein | hypothetical protein | ATPase, histidine kinase-, DNA gyrase B-, and HSP90-like domain protein | quaternary ammonium compound-resistance protein QacC, putative | type II/IV secretion system protein |
244 | 19 | 367 | -47.563 | 0.499 | Residual = 0.499 | | TgATaancTcaAcAAAAAacGAgG | aaGtCAagcGCCnTCAAGAGa | | DVU0909 DVU0915 DVU0920 DVU0921 DVU0926 DVU0929 DVU1098 DVU1707 DVU1708 DVU1709 DVU1736 DVU1988 DVU2198 DVU2249 DVU2250 DVU2296 DVU2645 DVU2646 DVU2831 | atpI obgE hsdM mtgA | hypothetical protein | ATP synthase protein I | 5-nitroimidazole antibiotic resistance protein, putative | GTPase ObgE | adenine specific DNA methyltransferase, putative | type I restriction-modification system, M subunit | AMP-binding protein | monofunctional biosynthetic peptidoglycan transglycosylase | Na+/H+ antiporter family protein | D-cysteine desulfhydrase |
245 | 21 | 361 | -29.709 | 0.565 | Residual = 0.565 | | TAACGgctCAAgTCCGCCTGaCGT | TTgGATTTAgGTTatAGGCaTGCA | | DVU0017 DVU0089 DVU0240 DVU1011 DVU1756 DVU1810 DVU1915 DVU1916 DVU2096 DVU2103 DVU2236 DVU2453 DVU2454 DVU2455 DVU2465 DVU2649 DVU2834 DVU2835 DVU3021 DVU3075 DVU3121 | | hypothetical protein | iron-sulfur cluster-binding/ATPase domain protein | NAD-dependent epimerase/dehydratase family protein | transcriptional regulator, putative | HDIG domain protein | aminotransferase, class V |
246 | 17 | 364 | -59.521 | 0.405 | Residual = 0.405 | | GTaTGaAAATAtgGATaTAAGAGA | aAggCtcTcaaAggAaacCATCAG | | DVU0252 DVU0472 DVU0473 DVU0475 DVU0553 DVU0630 DVU0670 DVU1479 DVU1646 DVU1706 DVU1750 DVU1995 DVU2114 DVU2392 DVU2717 DVU2725 DVU2726 | arsC | hypothetical protein | membrane protein, putative, truncation | exopolysaccharide production protein, putative | arsenate reductase | anti-anti-sigma factor | sigma-54 dependent transcriptional regulator/response regulator | type III secretion chaperone, CesT family |
247 | 28 | 364 | -29.890 | 0.487 | Residual = 0.487 | | AtnTtAcATTnTTaTaTGaa | TAtAAaAAtACAAAT | | DVU0026 DVU0049 DVU0094 DVU0100 DVU0101 DVU0103 DVU0130 DVU0233 DVU0360 DVU0446 DVU0533 DVU0534 DVU0588 DVU0593 DVU0678 DVU0791 DVU2090 DVU2570 DVU2687 DVU2730 DVU2829 DVU2849 DVU2999 DVU3244 DVU3372 DVU3384 DVUA0036 DVUA0089 | ilvB-1 zraP | hypothetical protein | OmpA family protein | methyl-accepting chemotaxis protein | TonB-dependent receptor | methlytransferase, UbiE/COQ5 family | cation ABC transporter, ATP-binding protein, putative | phosphoglycolate phosphatase, putative | acetolactate synthase catalytic subunit | sodium/solute symporter family protein | hmc operon protein 4 | hmc operon protein 3 | formate dehydrogenase, beta subunit, putative | L-lysine exporter, putative | methylated-DNA--protein-cysteine methyltransferase, DNA-binding domain protein | EF hand domain protein | GGDEF domain/HAMP domain protein | tail fiber protein, putative | methionyl-tRNA formyltransferase, putative | zinc resistance-associated protein | TPR domain protein |
248 | 16 | 366 | -53.025 | 0.416 | Residual = 0.416 | | TTTTCCG | aGTaTCTT | | DVU1197 DVU1198 DVU1199 DVU1203 DVU1204 DVU1304 DVU1305 DVU1306 DVU1307 DVU1314 DVU1315 DVU1321 DVU1322 DVU1623 DVU2226 DVU2929 | nusB ribH ribAB glyA fabF rplD rplW rplB rpsS rplX rplE rpmD rplO pyrG rpoC | N utilization substance protein B | riboflavin synthase, beta subunit | 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II | serine hydroxymethyltransferase | 3-oxoacyl-(acyl-carrier-protein) synthase II | 50S ribosomal protein L4 | 50S ribosomal protein L23 | 50S ribosomal protein L2 | 30S ribosomal protein S19 | 50S ribosomal protein L24 | 50S ribosomal protein L5 | 50S ribosomal protein L30 | 50S ribosomal protein L15 | CTP synthetase | acetyl-CoA carboxylase, biotin carboxylase, putative | DNA-directed RNA polymerase, beta prime subunit |
249 | 27 | 368 | -31.516 | 0.564 | Residual = 0.564 | | CTttgtctTgTGTcTTGtCgC | TtgtTaTttTcnAgAaGTtT | | DVU0121 DVU0521 DVU1051 DVU1283 DVU1372 DVU1373 DVU1374 DVU1375 DVU1377 DVU1378 DVU1881 DVU1882 DVU1883 DVU1887 DVU1910 DVU2328 DVU2430 DVU2508 DVU2509 DVU2514 DVU2612 DVU3045 DVU3097 DVU3112 DVU3113 DVU3197 DVU3335 | csrA ccmE galU divIVA ilvN-2 ilvC murF murE pyk carA ilvE | hypothetical protein | carbon storage regulator | cytochrome c-type biogenesis protein CcmE | UTP-glucose-1-phosphate uridylyltransferase | cell-division initiation protein DivIVA | acetolactate synthase, small subunit | ketol-acid reductoisomerase | phoH family protein | HDIG domain protein | YjeF-related protein | hydrogenase nickel insertion protein HypA, putative | RNA-binding protein | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase | UDP-N-acetylmuramoylalanyl-D-glutamate-2, 6-diaminopimelate ligase | pyruvate kinase | sensory box histidine kinase/response regulator | outer membrane efflux protein | TPR domain protein | carbamoyl phosphate synthase small subunit | branched-chain amino acid aminotransferase | sensory box histidine kinase |
250 | 29 | 368 | -33.152 | 0.515 | Residual = 0.515 | | GTgCGGcGtngnancaacnancg | ctTgcCAcGGcAGGG | | DVU0169 DVU0255 DVU0326 DVU0337 DVU0338 DVU0342 DVU0343 DVU0348 DVU0349 DVU0350 DVU0353 DVU0492 DVU1252 DVU1424 DVU1426 DVU1772 DVU1913 DVU1945 DVU1946 DVU2530 DVU2951 DVU3154 DVU3157 DVU3215 DVU3348 DVU3349 DVU3350 DVU3373 DVU3374 | hypE spsF argC gcvPB gcvH tkt glnS ilvD | oligopeptide/dipeptide ABC transporter, periplasmic oligopeptide/dipeptide-binding protein | hypothetical protein | hydrogenase expression/formation protein HypE | hydrolase, haloacid dehalogenase-like family | NAD-dependent epimerase/dehydratase family protein | HPCH/HPAI aldolase family protein | NeuB family protein | spore coat polysaccharide biosynthesis protein spsF | alcohol dehydrogenase, iron-containing | N-acetyl-gamma-glutamyl-phosphate reductase | glycine dehydrogenase subunit 2 | glycine cleavage system H protein | pyridine nucleotide-disulfide oxidoreductase | aspartate kinase, monofunctional class | 2-oxoglutarate ferredoxin oxidoreductase subunit alpha | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | transketolase | glutaminyl-tRNA synthetase | HAM1 family protein | response regulator | pyruvate ferredoxin/flavodoxin oxidoreductase, beta subunit, putative | 2-ketoisovalerate ferredoxin reductase | iron-sulfur cluster-binding protein | dihydroxy-acid dehydratase | permease, putative |
251 | 24 | 359 | -23.890 | 0.556 | Residual = 0.556 | | CAATTTtCCGCaAcA | AnATcCTGCTcGAA | | DVU0075 DVU0076 DVU0293 DVU0341 DVU1045 DVU1047 DVU1048 DVU1049 DVU1070 DVU1094 DVU1286 DVU1658 DVU1842 DVU1907 DVU1911 DVU2369 DVU2580 DVU2886 DVU2887 DVU3055 DVU3056 DVU3163 DVU3229 DVU3272 | ccmC ccmB argH ugd lpxD fliA | aminotransferase, DegT/DnrJ/EryC1/StrS family | glycosyl transferase, group 2 family protein | prokaryotic dksA/traR C4-type zinc finger family protein | 3-deoxy-manno-octulosonate cytidylyltransferase | hypothetical protein | cytochrome c-type biogenesis protein CcmC | cytochrome c-type biogenesis protein CcmB | ABC transporter, ATP-binding protein | branched chain amino acid ABC transporter, ATP-binding protein | argininosuccinate lyase | reductase, transmembrane subunit, putative | putative translaldolase | lipoprotein, putative | UDP-glucose 6-dehydrogenase | CBS domain protein | UDP-3-O-(R-3-hydroxymyristoyl)-glucosamine N-acyltransferase | response regulator | transcriptional regulator, AraC family | ribonuclease, Rne/Rng family | ABC transporter, permease protein | RNA polymerase sigma factor for flagellar operon FliA | TPR domain protein |
252 | 1 | 352 | -140.339 | 1.000 | Residual = 1.000 | |
|
| | DVU3341 | | hypothetical protein |
253 | 11 | 367 | -101.495 | 0.328 | Residual = 0.328 | | GcAcCGAtGCgGgaGCGAAG | TTgcTtGtggTTGa | | DVU1740 DVU1741 DVU2003 DVU2153 DVU2154 DVU2156 DVU2159 DVU2160 DVU2172 DVU2344 DVU2706 | | hypothetical protein | transposase, IS5 family, truncation | tail fiber protein, putative | tail assembly protein, putative |
254 | 29 | 364 | -22.703 | 0.562 | Residual = 0.562 | | TcCgGgGtGCGCc | aCtTCAGGaGaanG | | DVU0182 DVU0491 DVU0574 DVU1055 DVU1066 DVU1258 DVU1284 DVU1390 DVU1394 DVU1395 DVU1429 DVU1477 DVU1873 DVU2188 DVU2382 DVU2434 DVU2561 DVU2564 DVU2566 DVU2641 DVU2642 DVU2971 DVU3118 DVU3123 DVU3219 DVU3279 DVU3341 DVU3376 DVU3378 | gpt glnN priA ppiB-2 bioF lysA-2 cobT | radical SAM domain protein | HDIG domain protein | hypothetical protein | heptosyltransferase family protein | xanthine-guanine phosphoribosyltransferase | glutamine synthetase, type III | primosomal protein n' | C4-type zinc finger protein, DksA/TraR family | translation-associated GTPase | peptidyl-prolyl cis-trans isomerase B | primase, putative | oxidoreductase, short chain dehydrogenase/reductase family | 8-amino-7-oxononanoate synthase | diaminopimelate decarboxylase | lipoprotein, putative | alanyl-tRNA synthetase family protein, putative | glycosyl transferase, family 8 | HD domain protein | nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase | sulfatase family protein | YbaK/EbsC protein |
255 | 21 | 363 | -28.369 | 0.545 | Residual = 0.545 | | TTTTTTaCTgC | TnTCgtATtcATGCA | | DVU0105 DVU0107 DVU0225 DVU0226 DVU0227 DVU0356 DVU0357 DVU0500 DVU0547 DVU0624 DVU0625 DVU0702 DVU1238 DVU1290 DVU2200 DVU2205 DVU2407 DVUA0006 DVUA0072 DVUA0073 DVUA0075 | glnH tag selB glutamine-hydrolyzing | glutamine ABC transporter, ATP-binding protein | glutamine ABC transporter, periplasmic glutamine-binding protein | hypothetical protein | DNA-3-methyladenine glycosylase I | selenocysteine-specific translation elongation factor | high-affinity branched chain amino acid ABC transporter, periplasmic branched chain amino acid-binding protein | NapC/NirT cytochrome c family protein | cytochrome c nitrite reductase, catalytic subunit NfrA, putative | cytochrome c family protein | amino acid ABC transporter, periplasmic amino acid-binding protein | nitrate reductase, gamma subunit, putative | tryptophan-specific transport protein | magnesium transporter MgtE, putative | glycosyl transferase, group 1 family protein | asparagine synthase (glutamine-hydrolyzing), putative | radical SAM domain protein |
256 | 18 | 371 | -56.164 | 0.504 | Residual = 0.504 | | GaatTcTTTgTTnTTaTTttatAa | TtcTgtacgttcaAAAAtGTA | | DVU0099 DVU0100 DVU0770 DVU0948 DVU0949 DVU1230 DVU1231 DVU1698 DVU1699 DVU1737 DVU2592 DVU2814 DVU2815 DVU2816 DVU2817 DVU2818 DVU2819 DVU3326 | amt | TonB domain protein | TonB-dependent receptor | hypothetical protein | ammonium transporter | outer membrane efflux protein | multidrug resistance protein | transcriptional regulator, TetR family | multidrug resistance protein, Smr family |
257 | 13 | 366 | -104.030 | 0.317 | Residual = 0.317 | | TGACAGTAGGCaCgGCAAAAG | nCAgGtggCGcAgcTtCntC | | DVU0474 DVU2097 DVUA0008 DVUA0014 DVUA0037 DVUA0039 DVUA0041 DVUA0045 DVUA0056 DVUA0062 DVUA0063 DVUA0065 DVUA0090 | glnB-3 | ISDvu4, transposase | transcriptional regulator, putative | nitrogenase molybdenum-iron cofactor biosynthesis protein NifN, putative | nitrogen regulatory protein P-II | sugar transferase domain protein | chain length determinant family protein | hypothetical protein | aminotransferase, DegT/DnrJ/EryC1/StrS family | Orn/DAP/Arg family decarboxylase | sensor histidine kinase |
258 | 25 | 370 | -24.932 | 0.529 | Residual = 0.529 | | TCGgCATCAaTCCTGTCgGA | ACAaCACACACCATC | | DVU0187 DVU0704 DVU1061 DVU1176 DVU1217 DVU1254 DVU1255 DVU1386 DVU1387 DVU1807 DVU1808 DVU1826 DVU1827 DVU1828 DVU2053 DVU2259 DVU2260 DVU2335 DVU2355 DVU2376 DVU2535 DVU2553 DVU3053 DVU3059 DVU3159 | lepB nadC nadA gidA rrmJ trmH lysS rplT ftsY gpsA | GGDEF domain protein | signal peptidase I | glycosyl transferase, group 1 family protein | hypothetical protein | MATE efflux family protein | Sua5/YciO/YrdC/YwlC family protein | nicotinate-nucleotide pyrophosphorylase | quinolinate synthetase | succinyl-diaminopimelate desuccinylase | tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA | ribosomal RNA large subunit methyltransferase J | tRNA (guanosine-2'-O-)-methyltransferase | lysyl-tRNA synthetase | 50S ribosomal protein L20 | NifU family protein | signal recognition particle-docking protein FtsY | glycerol-3-phosphate dehydrogenase (NAD(P)+) |
259 | 10 | 365 | -69.425 | 0.394 | Residual = 0.394 | | GTCTCgTttTCcATGcCG | CTGCgCgGcAacaGGGAtG | | DVU0888 DVU1107 DVU2120 DVU2127 DVU2129 DVU2151 DVU2157 DVU2191 DVU2194 DVU3306 | | response regulator | tail tape measure protein | hypothetical protein | von Willebrand factor type A domain protein | sensory box histidine kinase/response regulator | tail tape meausure protein, putative |
260 | 17 | 366 | -27.632 | 0.591 | Residual = 0.591 | | AACCCCcgTgcAgcAAtggTAgAA | TGatGCTGgCA | | DVU0011 DVU0685 DVU0737 DVU0738 DVU0739 DVU0765 DVU0804 DVU1024 DVU1261 DVU1262 DVU1804 DVU2314 DVU2393 DVU2419 DVU2587 DVU2784 DVU2950 | rluD/coaE | TRAP transporter solute receptor DctP | phosphomannomutase | sensory box histidine kinase | substrate-binding protein, putative | conserved hypothetical protein TIGR00296 | hydroxypyruvate reductase, putative | sigma-54 dependent transcriptional regulator/response regulator | ribosomal large subunit pseudouridine synthase D/dephospho-CoA kinase | hypothetical protein | twitching motility protein PilT | glycosyl transferase, group 1 family protein | sensor histidine kinase | dehydrogenase, FMN-dependent family |
261 | 27 | 365 | -30.116 | 0.526 | Residual = 0.526 | | GcTgTTCA | ACAGCAGACCCATGCGGAGGACAC | | DVU0026 DVU0164 DVU0272 DVU0329 DVU0436 DVU1071 DVU1667 DVU1763 DVU1764 DVU1765 DVU1766 DVU1767 DVU1768 DVU1802 DVU1856 DVU1956 DVU2268 DVU2277 DVU2301 DVU2311 DVU2350 DVU2466 DVU2760 DVU2772 DVU2909 DVU3202 DVU3366 | thiH gid def | hypothetical protein | cation efflux family protein | transcriptional regulator, TetR family | FtsK/SpoIIIE family protein | thiamine biosynthesis protein ThiH | aspartate ammonia-lyase | biotin synthase | GTP-binding protein | heptosyltransferase family protein | lipoprotein, putative | tRNA (uracil-5-)-methyltransferase Gid | flocculin repeat domain | transcriptional regulator, MarR family | hydrolase, TatD family | polypeptide deformylase |
262 | 26 | 359 | -24.525 | 0.584 | Residual = 0.584 | | TtGTgAAA | AAAnTGTGCTTTtCCgCTcCaTT | | DVU0095 DVU0096 DVU0386 DVU0477 DVU0712 DVU0937 DVU1095 DVU1777 DVU1912 DVU1934 DVU1937 DVU2098 DVU2205 DVU2342 DVU2347 DVU2348 DVU2364 DVU2529 DVU2792 DVU2793 DVU2794 DVU2795 DVU2796 DVU2798 DVU2931 DVU3171 | potC icd argG cynT cooS argD dut pgk | polyamine ABC transporter, periplasmic polyamine-binding protein | spermidine/putrescine ABC transporter membrane protein | amino acid ABC transporter, periplasmic amino acid-binding protein | isocitrate dehydrogenase, NADP-dependent | amino acid ABC transporter, periplasmic-binding protein | hypothetical protein | argininosuccinate synthase | carbonic anhydrase | conserved hypothetical protein TIGR00150 | phosphonate ABC transporter, permease protein | phosphonate ABC transporter, periplasmic phosphonate-binding protein, putative | carbon monoxide dehydrogenase | tryptophan-specific transport protein | acetylornithine aminotransferase | deoxyuridine 5'-triphosphate nucleotidohydrolase | aminotransferase, classes I and II | phosphoglycerate kinase | electron transport complex protein RnfC, putative | electron transport complex protein RnfD, putative | electron transport complex protein RnfG, putative | SoxR-reducing system protein RsxE | electron transport complex protein RnfA, putative | ApbE family protein | sensory box histidine kinase | cytochrome c3 |
263 | 23 | 362 | -36.418 | 0.485 | Residual = 0.485 | | aacGnTTTATggttT | ataAnAttGAAAnAt | | DVU0030 DVU0369 DVU0560 DVU0618 DVU1257 DVU1561 DVU1564 DVU1690 DVU1705 DVU2000 DVU2007 DVU2096 DVU2106 DVU2182 DVU2183 DVU2198 DVU2451 DVU2452 DVU2651 DVU2718 DVU2745 DVU2778 DVUA0028 | | transcriptional regulator, GntR family | hypothetical protein | RNA-binding protein | molybdenum-binding protein, HTH domain | transcriptional regulator, TetR family | type I restriction-modification enzyme, S subunit | nuclease, putative | sigma-54 dependent transcriptional regulator | L-lactate permease family protein |
264 | 13 | 368 | -57.188 | 0.397 | Residual = 0.397 | | CgCTACaGgct | tGCTtCCTGtCacG | | DVU0016 DVU0444 DVU1265 DVU1695 DVU2192 DVU2218 DVU2595 DVU2631 DVU2740 DVU2754 DVU2828 DVU3251 DVU3370 | livF qor | hypothetical protein | CBS domain protein | tail fiber assembly protein, putative | GTP-binding protein, putative | high-affinity branched-chain amino acid ABC transporter, ATP-binding protein | quinone oxidoreductase | site-specific recombinase, phage integrase family | membrane protein, HPP family |
265 | 18 | 368 | -28.068 | 0.509 | Residual = 0.509 | | cGGCTgCggCAgaA | AAGAAAGA | | DVU0705 DVU1527 DVU1697 DVU1726 DVU1727 DVU2064 DVU2069 DVU2070 DVU2071 DVU2137 DVU2273 DVU2593 DVU2737 DVU2875 DVU2877 DVU2878 DVU2907 DVUA0127 | dctM sucCD umuD | TRAP transporter, DctM subunit | site-specific recombinase, phage integrase family | hypothetical protein | oxidoreductase, 2-nitropropane dioxygenase family | DNA processing protein DprA, putative | TPR domain protein | succinyl-CoA synthase, beta/alpha subunits | RNA methyltransferase, TrmH family | DNA-binding domain, excisionase family | adenine specific DNA methyltransferase, putative | umuD protein |
266 | 25 | 364 | -28.077 | 0.513 | Residual = 0.513 | | ATttTaTgcTGagATTaATctTaA | AcGGCAAGcA | | DVU0692 DVU0693 DVU0694 DVU0834 DVU0912 DVU0917 DVU0919 DVU1109 DVU1121 DVU1235 DVU1264 DVU1296 DVU1751 DVU1794 DVU1795 DVU1902 DVU1932 DVU2002 DVU2033 DVU2102 DVU2696 DVU2697 DVU3276 DVUA0098 DVUA0134 | rnhB atpE hup-3 adk cas1 | molybdopterin oxidoreductase, transmembrane subunit, putative | molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative | molybdopterin oxidoreductase, molybdopterin-binding subunit, putative | ribonuclease HII | hypothetical protein | ATP synthase F0, C subunit | ATPase domain protein | transglycosylase SLT domain protein | DNA-binding protein HU | adenylate kinase | outer membrane protein, OMP85 family | ferredoxin I | dehydrogenase, putative | CRISPR-associated protein Cas1 |
267 | 17 | 365 | -24.375 | 0.581 | Residual = 0.581 | | CGagGcCcatagtgaAcGgcA | TnTgCcCcnCttcaACGgca | | DVU0040 DVU0048 DVU0155 DVU0791 DVU0818 DVU1014 DVU1031 DVU1126 DVU1227 DVU1731 DVU1939 DVU2086 DVU2115 DVU2437 DVU3092 DVU3111 DVU3242 | rpoZ | hypothetical protein | chemotaxis protein MotB | type I phosphodiesterase/nucleotide pyrophosphatase family protein | methylated-DNA--protein-cysteine methyltransferase, DNA-binding domain protein | lipoprotein, putative | anaerobic glycerol-3-phosphate dehydrogenase subunit B | transcriptional regulator, GntR family | ABC transporter, permease protein | transcriptional regulator, Crp/Fnr family | DNA-directed RNA polymerase, omega subunit |
268 | 21 | 363 | -40.774 | 0.469 | Residual = 0.469 | | AAcATcgtagcaaGacnagACAA | ATCtTTccG | | DVU0128 DVU0299 DVU0300 DVU0613 DVU0722 DVU1361 DVU1428 DVU1458 DVU1548 DVU1590 DVU2140 DVU2243 DVU2416 DVU2417 DVU2484 DVU2485 DVU2515 DVU2673 DVU2762 DVU3355 DVU3356 | lpxB pgm radA tmk glgB | hypothetical protein | anaerobic ribonucleoside triphosphate reductase | radical SAM domain protein | response regulator | lipid A disaccharide synthase | phosphoglucomutase | chemotaxis protein CheZ, putative | outer membrane transport protein, OmpP1/FadL/TodX family | DNA repair protein RadA | thymidylate kinase | glycogen branching enzyme | SlyX protein | cytochrome c family protein | HD domain protein | anaerobic glycerol-3-phosphate dehydrogenase, subunit A, truncation | SPFH domain/Band 7 family protein | NAD-dependent epimerase/dehydratase family protein |
269 | 17 | 373 | -31.531 | 0.524 | Residual = 0.524 | | AAATGaacTTTctcAtTGAaACA | AaATcAtAtannCggaCAtcgcAt | | DVU0244 DVU0573 DVU0589 DVU0771 DVU0981 DVU1142 DVU1545 DVU1800 DVU1973 DVU2245 DVU2408 DVU2687 DVU3076 DVU3077 DVU3123 DVU3124 DVU3393 | creA | hypothetical protein | creA protein | molybdopterin-guanine dinucleotide biosynthesis protein B, putative | molybdenum-pterin binding domain protein/site-specific recombinase, phage integrase family | multiphosphoryl transfer protein, putative | transcriptional regulator, putative | hemolysin-type calcium-binding repeat/calx-beta domain protein | rhodanese-like domain protein | mutT/nudix family protein | AhpC/TSA family protein | HD domain protein |
270 | 28 | 366 | -30.886 | 0.502 | Residual = 0.502 | | GCAAcGCaACC | AttCgtTgaCnaaaTtCTGnAAG | | DVU0422 DVU0527 DVU0668 DVU0786 DVU1044 DVU1240 DVU1251 DVU1258 DVU1273 DVU1429 DVU1694 DVU1703 DVU1878 DVU1879 DVU1890 DVU1897 DVU1898 DVU1949 DVU1951 DVU2043 DVU2317 DVU2567 DVU2579 DVU2678 DVU3052 DVU3066 DVU3258 DVU3279 | maF guaB glnN ltaE hemC glyS glyQ nifA-1 murA cobT | sensory box/GGDEF domain/EAL domain protein | septum formation protein Maf | methyl-accepting chemotaxis protein | penicillin-binding protein | inosine-5`-monophosphate dehydrogenase | hypothetical protein | glutamine synthetase, type III | bacterial type II/III secretion system protein | translation-associated GTPase | C4-type zinc finger protein, DksA/TraR family | type I restriction-modification enzyme, R subunit | threonine aldolase, low-specificity | glycosyl transferase, group 1 family protein | porphobilinogen deaminase | glycyl-tRNA synthetase, beta subunit | glycyl-tRNA synthetase subunit alpha | nif-specific regulatory protein | indolepyruvate ferredoxin oxidoreductase, alpha subunit, putative | methyl-accepting chemotaxis protein, putative | TPR domain protein | RNA pseudouridine synthase family protein | ABC transporter, ATP-binding protein | DNA-binding protein | UDP-N-acetylglucosamine 1-carboxyvinyltransferase | nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase |
271 | 7 | 356 | -21.097 | 0.599 | Residual = 0.599 | | CCTTcTGGtCAATG | CGaTTTT | | DVU0932 DVU1218 DVU1799 DVU1835 DVU2412 DVU2636 DVU2999 | fusA-2 | sensor histidine kinase | hypothetical protein | elongation factor G | biotin--acetyl-CoA-carboxylase ligase | sensory box histidine kinase | methionyl-tRNA formyltransferase, putative |
272 | 20 | 360 | -39.604 | 0.489 | Residual = 0.489 | | GCACACAAAggtCaaaanAatCcG | AtGTtAttTTatCTTGaTtgCAAA | | DVU0129 DVU0222 DVU0629 DVU0677 DVU0690 DVU0720 DVU0722 DVU1440 DVU2180 DVU2351 DVU2443 DVU2633 DVU2747 DVU2799 DVU2800 DVU2801 DVU2835 DVU2847 DVU2933 DVU3016 | rnc | sensory box/HDIG domain protein | hypothetical protein | transcriptional regulator, TetR family | transglycosylase domain protein | HAMP domain protein | response regulator | ribonuclease III | transcriptional regulator, putative | transcriptional regulator, MarR family | heavy metal translocating P-type ATPase | response regulator/sensory box/HDIG domain protein | B12 binding domain protein/radical SAM domain protein |
273 | 24 | 376 | -56.801 | 0.471 | Residual = 0.471 | | atCtcTATnTTTgaAatnTAt | aTTccAAcCtATtcaaCAAGGa | | DVU2009 DVU2012 DVU2015 DVU2016 DVU2021 DVU2023 DVU2024 DVU2025 DVU2026 DVU2027 DVU2028 DVU2031 DVU2034 DVU2035 DVU2037 DVU2038 DVU2039 DVU2040 DVU2041 DVU2042 DVU2043 DVU2045 DVU2046 DVU2047 | | hypothetical protein | GGDEF domain protein | plasmid stabilization system family protein | cobS protein, putative | Fic family protein |
274 | 30 | 371 | -32.323 | 0.538 | Residual = 0.538 | | ATGnaTcGaTgTAatGgatt | GTaCtTGgcGCAaGCctCTGAACA | | DVU0111 DVU0239 DVU0453 DVU0577 DVU0579 DVU0587 DVU0819 DVU1396 DVU1397 DVU1412 DVU1564 DVU1592 DVU1593 DVU1594 DVU1595 DVU1596 DVU1597 DVU1973 DVU1974 DVU2421 DVU2422 DVU2972 DVU3041 DVU3042 DVU3076 DVU3079 DVU3135 DVU3136 DVUA0023 DVUA0091 | fdnG-1 bfr cheY-1 cheA-1 cheR-1 cheB-1 katA | response regulator | hypothetical protein | ATP-dependent DNA helicase, UvrD/REP family | formate dehydrogenase formation protein FdhE, putative | molybdopterin-guanine dinucleotide biosynthesis protein A, putative | formate dehydrogenase, alpha subunit, selenocysteine-containing | FMN reductase, NADPH-dependent | bacterioferritin | glycerate dehydrogenase | arginine N-succinyltransferase, beta subunit, putative | chemotaxis protein CheY | chemotaxis protein CheA | chemotaxis protein methyltransferase | protein-glutamate methylesterase CheB | sulfite reductase, assimilatory-type | rhodanese-like domain protein | pyridine nucleotide-disulfide oxidoreductase | 4-oxalocrotonate tautomerase family protein | nitroreductase family protein | chemotaxis protein CheD, putative | cytochrome c553 | lipoprotein, putative | glyoxalase family protein | flavodoxin-like fold domain protein | ABC transporter, permease protein, putative | catalase |
275 | 19 | 373 | -32.190 | 0.592 | Residual = 0.592 | | AAAACtTTGTCTTtTAT | GaATccgGCAAtC | | DVU1262 DVU1339 DVU1340 DVU1341 DVU1342 DVU1343 DVU1345 DVU1348 DVU1350 DVU1693 DVU2256 DVU2284 DVU2358 DVU2418 DVU2594 DVU2613 DVU2660 DVU2743 DVU3250 | proS xseB dxs gltX-1 ruvA livH | twitching motility protein PilT | lipoprotein, putative | transcriptional regulator, Fur family | cation ABC transporter, permease protein | cation ABC transporter, ATP-binding protein, putative | cation ABC transporter, periplasmc-binding protein | prolyl-tRNA synthetase | exodeoxyribonuclease VII, small subunit | 1-deoxy-D-xylulose-5-phosphate synthase | glutamyl-tRNA synthetase | Holliday junction DNA helicase RuvA | hypothetical protein | vanZ-like family protein | high-affinity branched-chain amino acid ABC ransporter, permease protein |
276 | 10 | 367 | -82.421 | 0.368 | Residual = 0.368 | | CCAGtCaaGAC | CAtGCATaTAggATTTTG | | DVU0215 DVU1164 DVU2710 DVU2711 DVU2713 DVU2715 DVUA0007 DVUA0009 DVUA0010 DVUA0013 | amiF nifB glnB-2 | tail protein, putative | formamidase | hypothetical protein | major head subunit, putative | nitrogenase cofactor biosynthesis protein NifB | nitrogenase MoFe cofactor biosynthesis protein NifE domain protein | ferredoxin, 2fe-2s | nitrogen regulatory protein P-II |
277 | 30 | 360 | -28.861 | 0.559 | Residual = 0.559 | | AaAtTActtGCAgAAtGtGaAtAT | tGAcaGcCTGTACA | | DVU0082 DVU0270 DVU0271 DVU0352 DVU0485 DVU0659 DVU0686 DVU0688 DVU0815 DVU0907 DVU0908 DVU0961 DVU0969 DVU1007 DVU1189 DVU1362 DVU1363 DVU1364 DVU1366 DVU1595 DVU1892 DVU2239 DVU2240 DVU2244 DVU2302 DVU2357 DVU2545 DVU2546 DVU2575 DVU2897 | cobU rfbD rfbB cheR-1 glgA | hypothetical protein | sensory box histidine kinase | response regulator | aminotransferase, DegT/DnrJ/EryC1/StrS family | iron-sulfur cluster-binding protein | AsmA family protein | iron-sulfur cluster-binding protein, putative | efflux protein, LysE family | cobinamide kinase/cobinamide phosphate guanylyltransferase | dTDP-4-dehydrorhamnose reductase | dTDP-glucose 4,6-dehydratase | lipoprotein, putative | chemotaxis protein methyltransferase | glycosyl transferase, group 2 family protein | glycosyl hydrolase, family 3 | hydantoinase/oxoprolinase family protein | glycogen synthase | glutathione-regulated potassium-efflux system protein KefB, putative | HD domain protein | alcohol dehydrogenase, iron-containing | peptidase, M20/M25/M40 family |
278 | 29 | 365 | -23.273 | 0.551 | Residual = 0.551 | | CGTCCGaCtCctacttTTTCaG | AAAGACTT | | DVU0135 DVU0450 DVU0660 DVU0723 DVU0724 DVU0768 DVU0769 DVU0808 DVU0869 DVU1060 DVU1215 DVU1454 DVU1538 DVU1573 DVU2209 DVU2436 DVU2581 DVU2756 DVU2872 DVU2902 DVU2916 DVU2945 DVU2995 DVU3050 DVU3109 DVU3116 DVU3207 DVU3223 DVU3361 | ribF purT murI gatA uppS ispD pth pyrC hemK prfC aspB | hypothetical protein | riboflavin biosynthesis protein RibF | phosphodiesterase | phosphoribosylglycinamide formyltransferase 2 | sodium/alanine symporter family protein | glutamate racemase | pyridoxamine kinase | glutamyl-tRNA(Gln) amidotransferase, A subunit | undecaprenyl diphosphate synthase | glycosyl transferase, group 1 family protein | PAP2 family protein | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | peptidyl-tRNA hydrolase | response regulator | radical SAM domain protein | phage portal protein, lambda family | dihydroorotase | hemK protein | iron-sulfur cluster-binding protein | peptide chain release factor 3 | RNB-like family protein | aspartate aminotransferase | ADP-heptose synthase, putative |
279 | 30 | 360 | -24.317 | 0.582 | Residual = 0.582 | | tgcTGAngtAgTTtTtgcnTGAca | AaGGaActGGTcAT | | DVU0035 DVU0163 DVU0564 DVU0999 DVU1016 DVU1145 DVU1181 DVU1331 DVU1333 DVU1678 DVU1679 DVU1689 DVU1701 DVU1760 DVU1801 DVU1905 DVU2004 DVU2264 DVU2648 DVU2649 DVU2654 DVU2657 DVU2669 DVU2675 DVU2727 DVU2956 DVU2969 DVU3083 DVU3313 DVU3327 | rimI idi | hypothetical protein | lipoprotein, putative | ISDvu4, transposase, truncation | thio:disulfide interchange protein, putative | response regulator | transcriptional regulator, LysR family | ribosomal-protein-alanine acetyltransferase | isopentenyl-diphosphate delta-isomerase | transcriptional regulator, TetR family | ISDvu4, transposase | 6-pyruvoyl tetrahydrobiopterin synthase, putative | DNA-binding response regulator, LuxR family | sigma-54 dependent transcriptional regulator | acetoacetyl-CoA synthase | multidrug resistance protein, Smr family |
280 | 23 | 371 | -44.206 | 0.458 | Residual = 0.458 | | TCCAtCTGTTTtTcAGATAGA | cGaCATCAatggCAt | | DVU0172 DVU0173 DVU0186 DVU0250 DVU0251 DVU0308 DVU0309 DVU1169 DVU2110 DVU2510 DVU2560 DVU2562 DVU2563 DVU2802 DVU2803 DVU2804 DVU2805 DVU2806 DVU2807 DVU3290 DVU3291 DVU3292 DVU3312 | | iron-sulfur cluster-binding protein | thiosulfate reductase, putative | hypothetical protein | transcriptional regulator, LysR family | methyl-accepting chemotaxis protein | L-lactate permease | penicillin-binding protein | acyl carrier protein, putative | beta-ketoacyl synthase, putative | transcriptional regulator, GntR family | metallo-beta-lactamase family protein | cobalamin synthesis protein/P47K family | MotA/TolQ/ExbB proton channel family protein | biopolymer transport protein, ExbD/TolR family | glutamate synthase, iron-sulfur cluster-binding subunit, putative | pyridine nucleotide-disulfide oxidoreductase |
281 | 20 | 368 | -33.641 | 0.493 | Residual = 0.493 | | ttTgTTCAtg | AtCgACATCGTCtGA | | DVU0025 DVU0233 DVU0234 DVU0235 DVU0370 DVU0577 DVU0578 DVU0579 DVU0580 DVU0596 DVU0597 DVU0600 DVU0601 DVU1418 DVU2414 DVU2588 DVU3036 DVU3269 DVU3381 DVU3382 | moaA lytR lytS ldh zraS | sensory box histidine kinase | hypothetical protein | formate dehydrogenase formation protein FdhE, putative | formate dehydrogenase accessory protein FdhD, putative | molybdopterin-guanine dinucleotide biosynthesis protein A, putative | molybdenum cofactor biosynthesis protein A | DNA-binding response regulator LytR | regulatory protein LytS | L-lactate dehydrogenase | phenylacetic acid degradation protein PaaI | DNA-binding response regulator | sensory box histidine kinase/response regulator | transcriptional regulatory protein zraR | sensor protein ZraS |
282 | 18 | 369 | -55.018 | 0.447 | Residual = 0.447 | | TTATaTtTGTcCaTTTcAtTGTT | CCaGAcAacAcGaTG | | DVU0551 DVU0734 DVU0789 DVU1082 DVU1291 DVU1292 DVU1579 DVU1582 DVU1583 DVU1584 DVU1587 DVU1620 DVU1663 DVU1672 DVU1673 DVU1818 DVU1828 DVU2890 | mreB-1 cysS secF gidA | high-affinity branched-chain amino acid ABC transporter ATP-binding protein | uroporphyrinogen III synthase/methyltransferase | rod shape-determining protein MreB | 3'- 5' exonuclease domain protein | hypothetical protein | cysteinyl-tRNA synthetase | TPR domain protein | sigma 70 family protein | acetyltransferase | permease, putative | acyltransferase, putative | preprotein translocase subunit SecF | tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA |
283 | 25 | 364 | -28.033 | 0.568 | Residual = 0.568 | | CAcgACCtCTTCctTTtGcAGaGa | CTgcAttAgCCcCCAattAGG | | DVU0023 DVU0564 DVU0604 DVU0717 DVU0879 DVU0923 DVU1111 DVU1144 DVU1145 DVU1184 DVU1400 DVU1511 DVU1512 DVU1758 DVU1915 DVU1974 DVU1992 DVU2004 DVU2107 DVU2128 DVU2176 DVU2184 DVU2221 DVU2246 DVU2354 | | hypothetical protein | ISDvu4, transposase, truncation | GGDEF domain/EAL domain protein | endoribonuclease, L-PSP family | transcriptional regulator, Cro/CI family | methyl-accepting chemotaxis protein | lipoprotein, putative | pyridine nucleotide-disulfide oxidoreductase | antibiotic acetyltransferase | ISDvu4, transposase | DNA-binding domain, excisionase family | S1 RNA binding domain protein | glycosyl transferase, group 2 family protein |
284 | 17 | 369 | -32.136 | 0.495 | Residual = 0.495 | | GCnCacCATCc | GCCtTCGgCAccGtc | | DVU0008 DVU0181 DVU0185 DVU0283 DVU0877 DVU1416 DVU1899 DVU2147 DVU2204 DVU2303 DVU2334 DVU2346 DVU3000 DVU3007 DVU3034 DVU3057 DVU3214 | modB tnaA | hypothetical protein | molybdenum ABC transporter, permease protein | AhpF family protein/thioredoxin reductase | DNA repair protein RecO, putative | L-serine dehydratase, putative | tryptophanase | oxygen-independent coproporphyrinogen III oxidase, putative | phosphoenolpyruvate synthase-related protein |
285 | 24 | 364 | -46.528 | 0.560 | Residual = 0.560 | | tGTCTttATAGCtTgtcAtC | TGTTatAcATGTCAcaAgTC | | DVU0037 DVU0129 DVU0278 DVU0541 DVU0583 DVU0944 DVU1902 DVU2516 DVU2633 DVU2635 DVU2956 DVU2957 DVU2958 DVU2959 DVU2960 DVU2961 DVU2962 DVU2963 DVU2964 DVU2965 DVU2966 DVU2967 DVU2970 DVU3295 | | hypothetical protein | sensory box/HDIG domain protein | glyoxalase family protein | lipoprotein, putative | CBS domain protein | transcriptional regulator, putative | glycosyl transferase, group 1 family protein | sigma-54 dependent transcriptional regulator | sensor histidine kinase | response regulator | sensor histidine kinase/response regulator | acetyltransferase, GNAT family | hemolysin III |
286 | 25 | 370 | -42.617 | 0.466 | Residual = 0.466 | | CAtGcAGcGGAAAaaAgtagCAG | TanTGGCAtGnnTttTGCTt | | DVU0043 DVU0044 DVU0045 DVU0307 DVU0317 DVU0318 DVU0320 DVU0410 DVU0518 DVU1441 DVU1442 DVU1443 DVU1444 DVU1805 DVU1854 DVU1880 DVU1961 DVU1963 DVU2065 DVU2444 DVU2445 DVU2991 DVU3002 DVU3232 DVU3234 | fliQ fliP flgE flgD cheW-3 flhA | flagellar biosynthetic protein FliQ | flagellar biosynthesis protein FliP | flagellar biosynthesis protein, FliO, putative | flagella basal body rod domain protein | hypothetical protein | TPR domain protein | flagellin | flagellin FlaG, putative | flagellar hook protein FlgE | basal-body rod modification protein FlgD | GGDEF domain protein | chemotaxis protein CheW | flagellar biosynthesis protein A | flagellar biosynthetic protein FliR |
287 | 12 | 370 | -91.985 | 0.312 | Residual = 0.312 | | GtGgCTTAtCtgAgAGgcaGA | ttATnnTtnTcAGGAggAA | | DVU0419 DVU0572 DVU0813 DVU1457 DVU1601 DVU1875 DVU1876 DVU1984 DVU2325 DVU2497 DVU2893 DVU2975 | nspC hrcA msrA merP | carboxynorspermidine decarboxylase | hypothetical protein | heat-inducible transcription repressor HrcA | thioredoxin reductase, putative | ATP-dependent Clp protease adaptor protein ClpS | dafA protein | dnaJ protein, putative | peptide methionine sulfoxide reductase MsrA | mercuric transport protein periplasmic component | lipoprotein, putative | flagellar basal-body rod protein, putative | hydrolase, putative |
288 | 17 | 369 | -79.275 | 0.417 | Residual = 0.417 | | ATTGCCAAAAgTGaTATaTAGCAA | ACcAGAAnGCGCcccacGgCGCAA | | DVU0165 DVU0166 DVU0167 DVU0168 DVU0384 DVU0386 DVU0387 DVU0388 DVU0390 DVU1038 DVU1089 DVU1260 DVU1351 DVUA0069 DVUA0070 DVUA0074 DVUA0076 | flr hisA alaS | oligopeptide/dipeptide ABC transporter, ATP-binding protein | oligopeptide/dipeptide ABC transporter, permease protein | flavoredoxin | amino acid ABC transporter, periplasmic amino acid-binding protein | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | amino acid ABC transporter, ATP-binding protein | glycolate oxidase, subunit GlcD, putative | phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase | alanyl-tRNA synthetase | outer membrane protein P1, putative | membrane protein, MarC family | GtrA family protein, selenocysteine-containing | hypothetical protein | sulfotransferase family protein | ABC transporter, ATP-binding protein |
289 | 26 | 365 | -31.858 | 0.529 | Residual = 0.529 | | AcAtGcaTgaCAtATGCtnCc | cGgCATcaagagCAT | | DVU0093 DVU0094 DVU0525 DVU0673 DVU1153 DVU1154 DVU1641 DVU1642 DVU1730 DVU1821 DVU1822 DVU1823 DVU2062 DVU2072 DVU2073 DVU2074 DVU2190 DVU2423 DVU2694 DVU2742 DVU2744 DVU3244 DVU3289 DVUA0082 DVUA0083 DVUA0084 | cheA-3 cheY-2 livM | conserved domain protein/glycosyl transferase, group 1 family protein | methyl-accepting chemotaxis protein | transcriptional regulator, MarR family | hypothetical protein | DNA-binding protein | glutamate synthase, amidotransferase subunit, putative | glutamate synthase, iron-sulfur cluster-binding subunit, putative | ATP-dependent DNA helicase, UvrD/REP family | chemotaxis protein CheA | chemotaxis protein CheY | chemotaxis protein CheW | transcriptional regulator, putative | high-affinity branched chain amino acid ABC transporter, permease protein | high-affinity branched-chain amino acid ABC transporter, perisplasmic amino acid binding protein | site-specific recombinase, phage integrase family | transcriptional regulator, AbrB family |
290 | 9 | 373 | -89.326 | 0.333 | Residual = 0.333 | | aAACAAAC | ACTAACaTcACtAaT | | DVU0475 DVU1510 DVU2006 DVU2105 DVU2686 DVU2836 DVU2837 DVU2838 DVU2839 | | membrane protein, putative, truncation | hypothetical protein | peptidase, S24 family |
291 | 31 | 366 | -21.697 | 0.602 | Residual = 0.602 | | TgcCgTtgtCgcccgGCCcGtgTT | TTTcCATGTGAAgC | | DVU0022 DVU0364 DVU0614 DVU0679 DVU0680 DVU0681 DVU0733 DVU0826 DVU0827 DVU0828 DVU0829 DVU0890 DVU0905 DVU0924 DVU0933 DVU1352 DVU1386 DVU1403 DVU1999 DVU2036 DVU2131 DVU2314 DVU2331 DVU2433 DVU2525 DVU2620 DVU2748 DVU2934 DVU3051 DVU3237 DVU3363 | pabA smpB ptsI hom lipA rumA cobO hynB-2 cobM mutT sun | HAMP domain/GGDEF domain/EAL domain protein | para-aminobenzoate/anthranilate synthase glutamine amidotransferase | hypothetical protein | sigma-54 dependent transcriptional regulator/response regulator | sensory box histidine kinase | sensor histidine kinase/response regulator | glycolate oxidase, iron-sulfur subunit, putative | glycolate oxidase, subunit GlcD, putative | SsrA-binding protein | phosphoenolpyruvate-protein phosphotransferase | homoserine dehydrogenase | lipoyl synthase | 23S rRNA (uracil-5-)-methyltransferase RumA | response regulator | 6-pyruvoyl tetrahydrobiopterin synthase, putative | cob(I)alamin adenosyltransferase | sulfate transporter family protein | helix-turn-helix protein, CopG family | Smr family protein | periplasmic [NiFe] hydrogenase, small subunit, isozyme 2 | precorrin-4 C11-methyltransferase | mutator mutT protein | phosphoenolpyruvate synthase-related protein | sun protein |
292 | 25 | 369 | -37.111 | 0.561 | Residual = 0.561 | | AAAGcCCCgtGCTcgCAtcngGCA | AcAaACtcgTGATTTTcgG | | DVU0341 DVU0398 DVU0400 DVU0402 DVU0403 DVU0404 DVU0751 DVU0752 DVU0753 DVU1199 DVU1314 DVU1531 DVU1586 DVU1623 DVU1624 DVU1625 DVU1866 DVU1911 DVU2226 DVU2531 DVU2534 DVU2537 DVU2538 DVU3176 DVU3178 | dsvA dvsB ribAB rplX pyrG kdsA rpe pheS infC thrS | 3-deoxy-manno-octulosonate cytidylyltransferase | HMGL-like domain protein | hypothetical protein | dissimilatory sulfite reductase alpha subunit | dissimilatory sulfite reductase beta subunit | dissimilatory sulfite reductase B | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | amino acid ABC transporter, amino acid-binding protein | amino acid ABC transporter, ATP-binding protein | 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II | 50S ribosomal protein L24 | methyltransferase, putative | thioredoxin family protein | CTP synthetase | 2-dehydro-3-deoxyphosphooctonate aldolase | phosphatase, YrbI family | CBS domain protein | acetyl-CoA carboxylase, biotin carboxylase, putative | ribulose-phosphate 3-epimerase | phenylalanyl-tRNA synthetase, alpha subunit | translation initiation factor IF-3 | threonyl-tRNA synthetase | UDP-glucose/GDP-mannose dehydrogenase family protein |
293 | 13 | 377 | -80.524 | 0.375 | Residual = 0.375 | | AgCGGGCGtGGCaG | CCgTGtCgCGCA | | DVU1715 DVU1717 DVU1718 DVU1719 DVU1720 DVU1721 DVU1723 DVU1725 DVU2597 DVU2789 DVUA0007 DVUA0008 DVUA0143 | nifB nifA-2 | hypothetical protein | Gpr1/Fun34/YaaH family protein | nitrogenase cofactor biosynthesis protein NifB | nitrogenase molybdenum-iron cofactor biosynthesis protein NifN, putative | Nif-specific regulatory protein |
294 | 19 | 364 | -33.882 | 0.555 | Residual = 0.555 | | AngtctTaTaTttgTcCnTnTtat | cCTGAAAAACa | | DVU0785 DVU1214 DVU1281 DVU1580 DVU1581 DVU1583 DVU1585 DVU1586 DVU1588 DVU1589 DVU1769 DVU1770 DVU1866 DVU1978 DVU2024 DVU2026 DVU2031 DVU2037 DVU3100 | rodA hpt hydA hydB | rod shape-determining protein RodA | dolichyl-phosphate-mannose-protein mannosyltransferase family protein | hypothetical protein | ribose 5-phosphate isomerase, putative | TPR domain protein | vitamin B12-dependent methionine synthase family protein | thioredoxin family protein | hypoxanthine phosphoribosyltransferase | periplasmic [Fe] hydrogenase, large subunit | periplasmic [Fe] hydrogenase, small subunit | Na+/H+ antiporter family protein | cobS protein, putative | biopolymer transport protein, ExbD/TolR family |
295 | 15 | 367 | -63.032 | 0.395 | Residual = 0.395 | | AAATaATaCACaAAA | CnTcCtGTCaggGa | | DVU0083 DVU0115 DVU0538 DVU1233 DVU1265 DVU1761 DVU2167 DVU2432 DVU2631 DVU2637 DVU2663 DVU2754 DVU2777 DVU3248 DVU3249 | aroE qor | hypothetical protein | shikimate 5-dehydrogenase | AP endonuclease, family 2 | protein-P-II uridylyltransferase, putative | sensory box/GGDEF domain/EAL domain protein | HAMP domain protein | quinone oxidoreductase | AcrB/AcrD/AcrF family protein | lipoprotein, putative |
296 | 28 | 366 | -24.570 | 0.578 | Residual = 0.578 | | CTCTTGAAaAtaATA | TCgTGCcTtcatCATGCtgt | | DVU0005 DVU0229 DVU0261 DVU0262 DVU0265 DVU0266 DVU0640 DVU0697 DVU0720 DVU0748 DVU0766 DVU0805 DVU0806 DVU0934 DVU0935 DVU0961 DVU1000 DVU1227 DVU1413 DVU1800 DVU1909 DVU1993 DVU2240 DVU2245 DVU2430 DVU2431 DVU2529 DVU3259 | pomA acs acpS pgk xth | lipoprotein, putative | hypothetical protein | universal stress protein family | chemotaxis protein PomA | mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase | HAMP domain protein | acetyl-CoA synthetase | transporter, putative | chemotaxis protein CheY, putative | methyl-accepting chemotaxis protein | peptidase, M24 family | holo-(acyl-carrier-protein) synthase | cation-transporting ATPase, E1-E2 family | hydantoinase/oxoprolinase family protein | mutT/nudix family protein | RNA-binding protein | phosphoglycerate kinase | exodeoxyribonuclease III |
297 | 19 | 365 | -55.578 | 0.433 | Residual = 0.433 | | TaGGTAGaancGntTTnnCGATGA | TTCCCTTgaCTTcT | | DVU0835 DVU0839 DVU0927 DVU0928 DVU1301 DVU1334 DVU1537 DVU1676 DVU1792 DVU1793 DVU1794 DVU1795 DVU1820 DVU1864 DVU1896 DVU2150 DVU2912 DVU2920 DVU2925 | rplS rpsP rplU rpmA tig secG rpsU hup-3 yajC rpsT rpmE tuf rplA | 50S ribosomal protein L19 | 30S ribosomal protein S16 | 50S ribosomal protein L21 | 50S ribosomal protein L27 | hypothetical protein | trigger factor | lipoprotein, putative | preprotein translocase subunit SecG | 30S ribosomal protein S21 | DNA-binding protein HU | preprotein translocase, YajC subunit | DNA-binding protein HU, beta subunit, putative | 30S ribosomal protein S20 | dnaK suppressor protein, putative | 50S ribosomal protein L31 | elongation factor Tu | 50S ribosomal protein L1 |
298 | 7 | 352 | -21.432 | 0.561 | Residual = 0.561 | | GgAAAAg | TaTGAtGCAA | | DVU0047 DVU0177 DVU0626 DVU0893 DVU1348 DVU1835 DVU2577 | modA ilvN-1 xseB | flagellar protein FliL | molybdenum ABC transporter, periplasmic molybdenum-binding protein | acetolactate synthase, small subunit | universal stress protein family | exodeoxyribonuclease VII, small subunit | biotin--acetyl-CoA-carboxylase ligase | DNA-binding response regulator, LuxR family |
299 | 16 | 372 | -54.089 | 0.435 | Residual = 0.435 | | ATGtGgagTtTTttttnGtTT | ACaAaATcagaAtaACantA | | DVU0185 DVU0442 DVU0443 DVU0445 DVU1105 DVU1414 DVU1503 DVU1721 DVU1967 DVU1968 DVU1969 DVU1970 DVU2168 DVU2171 DVU2173 DVU2187 | | hypothetical protein | phoH-related protein | exonulcease, putative | CBS domain protein | sensory box/GGDEF domain/EAL domain protein | terminase, large subunit | transcriptional regulator, rrf2 protein, putative | oxidoreductase, putative | response regulator | major head protein | portal protein |
300 | 15 | 366 | -60.460 | 0.368 | Residual = 0.368 | | TCAttTTtTTT | AGGaTGTg | | DVU0106 DVU0280 DVU0511 DVU0788 DVU1050 DVU1076 DVU1246 DVU1650 DVU1831 DVU1840 DVU1843 DVU2371 DVU2375 DVU3161 DVU3255 | glnP mreC ccmF | glutamine ABC transporter, permease protein | glycosyl transferase, group 1 family protein | hypothetical protein | rod shape-determining protein MreC | cytochrome c-type biogenesis protein CcmF | conserved hypothetical protein TIGR00278 | metalloendopeptidase, putative, glycoprotease family | N-acetylmuramoyl-L-alanine amidase, putative | lipoprotein releasing system, permease protein | ABC transporter, ATP-binding protein | transcriptional regulator, CopG family |
301 | 16 | 366 | -68.734 | 0.501 | Residual = 0.501 | | AGaCTTCtaCataATATcTaGa | CAtAGATGAAG | | DVU0891 DVU2288 DVU2499 DVU2500 DVU2501 DVU2503 DVU2504 DVU2505 DVU2506 DVU2507 DVU2508 DVU2509 DVU2511 DVU2512 DVU2513 DVU2515 | ftsZ ftsA murC murG murD mraY murF murE mraW mraZ | aminotransferase, classes I and II | hydrogenase, CooL subunit, putative | cell division protein FtsZ | cell division protein FtsA | cell division protein FtsQ, putative | UDP-N-acetylmuramate--alanine ligase | UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | cell cycle protein, FtsW/RodA/SpoVE family | UDP-N-acetylmuramoylalanine--D-glutamate ligase | phospho-N-acetylmuramoyl-pentapeptide- transferase | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase | UDP-N-acetylmuramoylalanyl-D-glutamate-2, 6-diaminopimelate ligase | hypothetical protein | S-adenosyl-methyltransferase MraW | HD domain protein |
302 | 1 | 361 | -143.948 | 1.000 | Residual = 1.000 | |
|
| | DVU2081 | | hypothetical protein |
303 | 18 | 371 | -50.812 | 0.429 | Residual = 0.429 | | CAngGTtTttTTAcAgCAATG | AAGATAAAATAACATCTTATTTAT | | DVU0656 DVU0657 DVU0713 DVU0940 DVU1376 DVU1462 DVU1464 DVU1650 DVU1651 DVU1682 DVU2323 DVU2608 DVU2799 DVU2800 DVU2801 DVU3085 DVU3261 DVU3356 | ilvB-2 motA-3 frdC | hypothetical protein | heat shock protein, Hsp20 family | branched-chain amino acid ABC transporter, permease protein | GGDEF domain protein | acetolactate synthase, large subunit, biosynthetic type | cytochrome c assembly protein, putative | heptosyltransferase family protein | GAF domain protein | flagellar motor protein MotA | transcriptional regulator, MarR family | heavy metal translocating P-type ATPase | fumarate reductase, cytochrome b subunit | NAD-dependent epimerase/dehydratase family protein |
304 | 29 | 367 | -18.415 | 0.572 | Residual = 0.572 | | TcCATGTCACA | CGGaTGCCCTG | | DVU0055 DVU0187 DVU0245 DVU0412 DVU0584 DVU0687 DVU0689 DVU0749 DVU0897 DVU0898 DVU0900 DVU0901 DVU0922 DVU0996 DVU1188 DVU1536 DVU2092 DVU2365 DVU2477 DVU2479 DVU2543 DVU2739 DVU2749 DVU2886 DVU2947 DVU2961 DVU3010 DVU3229 DVUA0072 | ispH rnhA gmk pyrF pstS cobL fliA | hydroxymethylbutenyl pyrophosphate reductase | GGDEF domain protein | protein phosphatase, putative | potassium uptake protein TrkA, putative | transposase, putative | aldehyde:ferredoxin oxidoreductase, tungsten-containing, putative | ribonuclease HI | DNA-binding response regulator | RNA modification enzyme, MiaB-family | hypothetical protein | guanylate kinase | orotidine 5`-phosphate decarboxylase | cytochrome c family protein | transglycosylase, SLT family | thiamine biosynthesis protein ThiF | phosphate ABC transporter, periplasmic phosphate-binding protein PstS | phosphate ABC transporter, permease protein, putative | hydroxylamine reductase | pyruvate phosphate dikinase, PEP/pyruvate binding domain protein | precorrin-6Y C5,15-methyltransferase (decarboxylating) | transcriptional regulator, AraC family | anaerobic ribonucleoside triphosphate reductase | aminotransferase, DegT/DnrJ/EryC1/StrS family | RNA polymerase sigma factor for flagellar operon FliA | glycosyl transferase, group 1 family protein |
305 | 24 | 369 | -26.238 | 0.585 | Residual = 0.585 | | CaGgTCATcGnCaAAGccG | AAgACCGgATG | | DVU0373 DVU0374 DVU0376 DVU0377 DVU0379 DVU0380 DVU0617 DVU1104 DVU1157 DVU1158 DVU1216 DVU1284 DVU2440 DVU2492 DVU2642 DVU2809 DVU2810 DVU2811 DVU2812 DVU3063 DVU3160 DVU3241 DVU3390 DVU3391 | trxB-1 priA trpF-2 fdnG-3 mviN-2 | CoA-binding domain protein | pyruvate ferredoxin/flavodoxin oxidoreductase family protein | hypothetical protein | thioredoxin reductase | transcriptional regulator, putative | sulfatase, putative | baseplate assembly protein, putative | sensory box histidine kinase | primosomal protein n' | N-(5'-phosphoribosyl)anthranilate isomerase | alanyl-tRNA synthetase family protein, putative | cytochrome c3 | formate dehydrogenase formation protein FdhE, putative | formate dehydrogenase, beta subunit, putative | formate dehydrogenase, alpha subunit, selenocysteine-containing | integral membrane protein MviN |
306 | 27 | 356 | -28.370 | 0.511 | Residual = 0.511 | | TagttaAnAnAAggcttGCcAcgC | GTtGCGTg | | DVU0836 DVU0867 DVU0931 DVU0956 DVU0966 DVU1046 DVU1049 DVU1069 DVU1237 DVU1249 DVU1270 DVU1274 DVU1287 DVU1288 DVU1289 DVU1411 DVU1746 DVU1848 DVU1900 DVU1936 DVU2113 DVU2285 DVU2335 DVU2533 DVU2927 DVU2928 DVU3253 | trmD thiD rpsF fabD thiC pheT rplL rpoB | tRNA (guanine-N1)-methyltransferase | aromatic amino acid decarboxylase, putative | phosphomethylpyrimidine kinase | 30S ribosomal protein S6 | amino acid ABC transporter, periplasmic amino acid-binding protein | hypothetical protein | ABC transporter, ATP-binding protein | branched chain amino acid ABC transporter, permease protein | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | malonyl CoA-acyl carrier protein transacylase | twitching motility protein | reductase, iron-sulfur binding subunit, putative | cytochrome c family protein | thiamine biosynthesis protein ThiC | C-5 cytosine-specific DNA methylase family protein | phosphonate ABC transporter, ATP-binding protein | xanthine/uracil permease family protein | L-lactate permease family protein | phenylalanyl-tRNA synthetase, beta subunit | 50S ribosomal protein L7/L12 | DNA-directed RNA polymerase subunit beta | phenylacetate-coenzyme A ligase, putative |
307 | 6 | 361 | -23.022 | 0.514 | Residual = 0.514 | | GcTTgaTGnTgCcC | AgGCAA | | DVU0922 DVU0996 DVU2046 DVU2085 DVU2776 DVU3264 | dsvC | cytochrome c family protein | hypothetical protein | Snf2 family protein | dissimilatory sulfite reductase, gamma subunit | fumarate hydratase |
308 | 27 | 366 | -32.914 | 0.506 | Residual = 0.506 | | AtACCcTgAgTGcGGAAAAtGCAA | CcCCgGgCAnGGcnT | | DVU0275 DVU0356 DVU0448 DVU1174 DVU1175 DVU1194 DVU1200 DVU1209 DVU1211 DVU1335 DVU1405 DVU1742 DVU1861 DVU1923 DVU2066 DVU2104 DVU2201 DVU2216 DVU2235 DVU2236 DVU2417 DVU2607 DVU2980 DVU3061 DVU3117 DVU3146 DVU3191 | tag gmd ribE rpmF rpmB clpP prfB hupD infA-2 pssA rluC | polysaccharide deacetylase family protein | DNA-3-methyladenine glycosylase I | GDP-mannose 4,6-dehydratase | hypothetical protein | riboflavin synthase subunit alpha | ribosomal protein L32 | 50S ribosomal protein L28 | ATP-dependent Clp protease, proteolytic subunit | prevent-host-death family protein | peptide chain release factor 2, programmed frameshift | hydrogenase expression/formation protein HupD | site-specific recombinase, phage integrase family | iron-sulfur cluster-binding/ATPase domain protein | alcohol dehydrogenase, iron-containing | translation initiation factor IF-1 | SlyX protein | CDP-diacylglycerol--serine O-phosphatidyltransferase | sensory box histidine kinase | ribosomal large subunit pseudouridine synthase C |
309 | 22 | 364 | -31.857 | 0.552 | Residual = 0.552 | | ACGATtcAAcGcgcaAcaaCAcAG | TnaTAgtntTcTgatAaACTa | | DVU0012 DVU0408 DVU0438 DVU0528 DVU0537 DVU0616 DVU0666 DVU0674 DVU0852 DVU1057 DVU1354 DVU1425 DVU1473 DVU1632 DVU1989 DVU2261 DVU2745 DVU2746 DVU2845 DVU3144 DVU3145 DVU3380 | gcvPA | hypothetical protein | response regulator/sensory box/GGDEF domain/EAL domain protein | AcrB/AcrD/AcrF family protein | phosphatidylglycerophosphatase | HD domain protein | ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | extracellular solute-binding protein, putative | cobalt ABC transporter, permease protein, putative | glycine dehydrogenase subunit 1 | PTS system, IIA component | HIT family protein | cytochrome c family protein | hydrogenase, b-type cytochrome subunit, putative |
310 | 10 | 368 | -124.834 | 0.236 | Residual = 0.236 | | CcGcCGGnGCGnCCgCctCG | TGaGCCA | | DVU0198 DVU0199 DVU0200 DVU0201 DVU0204 DVU0205 DVU0207 DVU0208 DVU2869 DVU2870 | | minor capsid protein C, degenerate | hypothetical protein | major head protein | lipoprotein, putative |
311 | 32 | 368 | -25.200 | 0.533 | Residual = 0.533 | | ATgtGcAAAA | aTGccGtCAT | | DVU0030 DVU0108 DVU0109 DVU0172 DVU0173 DVU0186 DVU0622 DVU0750 DVU1168 DVU1169 DVU1445 DVU1960 DVU2110 DVU2195 DVU2294 DVU2317 DVU2560 DVU2561 DVU2562 DVU2563 DVU2565 DVU2566 DVU2802 DVU2803 DVU2805 DVU2806 DVU2807 DVU3284 DVU3290 DVU3291 DVU3312 DVU3372 | cheA-2 bioD lysA-2 | transcriptional regulator, GntR family | hypothetical protein | sensor histidine kinase | iron-sulfur cluster-binding protein | thiosulfate reductase, putative | sensor histidine kinase/response regulator | methyl-accepting chemotaxis protein | flagellar hook-length control domain protein | chemotaxis protein CheA | L-lactate permease | femAB family protein | methyl-accepting chemotaxis protein, putative | oxidoreductase, short chain dehydrogenase/reductase family | acyl carrier protein, putative | beta-ketoacyl synthase, putative | dethiobiotin synthetase | diaminopimelate decarboxylase | cobalamin synthesis protein/P47K family | MotA/TolQ/ExbB proton channel family protein | biopolymer transport protein, ExbD/TolR family | glutamate synthase, iron-sulfur cluster-binding subunit, putative |
312 | 1 | 360 | -143.763 | 1.000 | Residual = 1.000 | |
|
| | DVU2101 | | hypothetical protein |
313 | 22 | 366 | -23.434 | 0.551 | Residual = 0.551 | | tCCTTCTTCT | ACCtTGCCnTC | | DVU0013 DVU0228 DVU0287 DVU0427 DVU0458 DVU1250 DVU1256 DVU1485 DVU1545 DVU1732 DVU1743 DVU1906 DVU1959 DVU2061 DVU2176 DVU2528 DVU2565 DVU2654 DVU2685 DVU2826 DVU3311 DVU3318 | gidB pfkA bioD | sensory box histidine kinase | hypothetical protein | methyltransferase GidB | heptosyltransferase family protein | hemolysin-type calcium-binding repeat/calx-beta domain protein | EAL domain/GGDEF domain protein | diphosphate--fructose-6-phosphate 1-phosphotransferase | dethiobiotin synthetase |
314 | 29 | 372 | -42.829 | 0.506 | Residual = 0.506 | | tCCGcTtggGGCacGAcCGgaT | TCggCacCGTCgaCA | | DVU0020 DVU0189 DVU0195 DVU0213 DVU0214 DVU0216 DVU0217 DVU0218 DVU0219 DVU0220 DVU0221 DVU0234 DVU0235 DVU1483 DVU1484 DVU1486 DVU2457 DVU2733 DVU2848 DVU2849 DVU2850 DVU2851 DVU2852 DVU2853 DVU2855 DVU2856 DVUA0001 DVUA0022 DVUA0033 | | hypothetical protein | phage/plasmid primase, P4 family | tail/DNA circulation protein, putative | phage baseplate assembly protein V, putative | tail protein, putative | tail fiber protein, putative | tail fiber assembly protein, putative | tail fiber protein, truncation | adenine specific DNA methyltransferase, putative | ABC transporter, ATP-binding protein |
315 | 22 | 364 | -17.887 | 0.619 | Residual = 0.619 | | ttccgGCCcTTTC | TGnTgTCCTgT | | DVU0098 DVU0440 DVU0679 DVU0707 DVU0730 DVU0933 DVU0934 DVU1170 DVU1728 DVU1787 DVU1960 DVU2307 DVU2365 DVU2797 DVU3099 DVU3102 DVU3112 DVU3114 DVU3166 DVU3252 DVU3369 DVUA0095 | potA dctP cheA-2 tolQ-2 kdsB | putrescine/spermidine ABC transporter ATPase protein | hypothetical protein | sigma-54 dependent transcriptional regulator/response regulator | TRAP transporter solute receptor DctP | response regulator | nuclease domain protein | chemotaxis protein CheA | C4-type zinc finger protein, DksA/TraR family | ferredoxin | tolQ protein | TPR domain protein | 3-deoxy-manno-octulosonate cytidylyltransferase | alanyl-tRNA synthetase family protein, putative |
316 | 25 | 364 | -24.946 | 0.613 | Residual = 0.613 | | GGCaGGgGTGATGcgGCA | aCtCCGCcccGagcAtGgGCgACA | | DVU0057 DVU0058 DVU0059 DVU0127 DVU0176 DVU1895 DVU2080 DVU2148 DVU2319 DVU2320 DVU2321 DVU2467 DVU2610 DVU2821 DVU2877 DVU2888 DVU2889 DVU2899 DVU3074 DVU3075 DVU3091 DVU3166 DVU3203 DVUA0059 DVUA0144 | rnr | transcriptional regulator, TetR family | efflux transporter, RND family, MFP subunit | AcrB/AcrD/AcrF family protein | hypothetical protein | glycerophosphoryl diester phosphodiesterase family protein | major facilitator superfamily protein | CBS/transporter associated domain protein | transcriptional regulator domain protein | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase family protein | ribonuclease R | cobalt ABC transporter, ATP-binding protein, putative | BioY family protein | alanyl-tRNA synthetase family protein, putative | DNA polymerase III, delta prime subunit, putative |
317 | 1 | 365 | -143.078 | 1.000 | Residual = 1.000 | |
|
| | DVU1365 | | heme-binding protein, putative |
318 | 26 | 364 | -29.020 | 0.558 | Residual = 0.558 | | CTTTTcCG | GCaTTCCGaCGTCG | | DVU0112 DVU0721 DVU0875 DVU0941 DVU0954 DVU1428 DVU1446 DVU1447 DVU1448 DVU1449 DVU1450 DVU1451 DVU1452 DVU1453 DVU1681 DVU1683 DVU1684 DVU1685 DVU1686 DVU1687 DVU1844 DVU2083 DVU2238 DVU2332 DVU2576 DVU2674 | pgm dtd fadD mreB-2 gcvT relA proC | deoxyribodipyrimidine photolyase, putative | sensory box histidine kinase | fumarylacetoacetate hydrolase family protein | peptidase, M16 family | organic solvent tolerance protein, putative | phosphoglucomutase | heptosyltransferase family protein | CgeB family protein | hypothetical protein | anti-anti-sigma factor, putative | anti-sigma factor, putative | response regulator | D-tyrosyl-tRNA deacylase | long-chain-fatty-acid--CoA ligase | rod shape-determining protein MreB | glycine cleavage system T protein | conserved hypothetical protein TIGR00046 | recombination factor protein RarA | glycosyl transferase, group 2 family protein | septum formation initiator family protein | GTP pyrophosphokinase | RNA methyltransferase, TrmH family | pyrroline-5-carboxylate reductase | oligopeptide ABC transporter, ATP-binding protein | succinate dehydrogenase and fumarate reductase iron-sulfur protein |
319 | 16 | 369 | -97.162 | 0.342 | Residual = 0.342 | | TAATTcTGTTTGAGTTGgtGgAtA | GGTgGTGAAt | | DVU0774 DVU0775 DVU0776 DVU0777 DVU0778 DVU0779 DVU0780 DVU0845 DVU0846 DVU0847 DVU0848 DVU0849 DVU0850 DVU0851 DVU0918 DVU1636 | atpC atpD atpG atpA atpH aprB aprA atpB ppaC | ATP synthase, F1 epsilon subunit | F0F1 ATP synthase subunit beta | ATP synthase, F1 gamma subunit | F0F1 ATP synthase subunit alpha | ATP synthase, F1 delta subunit | ATP synthase F0, B subunit, putative | ATP synthase F0, B' subunit, putative | hypothetical protein | adenylylsulphate reductase, beta subunit | adenylylsulfate reductase | heterodisulfide reductase, putative | heterodisulfide reductase, iron-sulfur-binding subunit, putative | heterodisulfide reductase, transmembrane subunit, putative | ATP synthase F0, A subunit | putative manganese-dependent inorganic pyrophosphatase |
320 | 8 | 353 | -19.567 | 0.552 | Residual = 0.552 | | AAAACcTCAACA | GAAAGCaTACtttC | | DVU0179 DVU0306 DVU0355 DVU0385 DVU0798 DVU1920 DVU3256 DVU3318 | mutM | molybdenum-pterin binding domain protein/site-specific recombinase, phage integrase family | hypothetical protein | sensory box/GGDEF domain protein | formamidopyrimidine-DNA glycosylase |
321 | 32 | 367 | -31.658 | 0.540 | Residual = 0.540 | | AAtATCATgtC | CAGCAtTGCagACGnCgCGaA | | DVU0330 DVU0331 DVU0591 DVU0592 DVU0700 DVU1474 DVU1991 DVU2117 DVU2118 DVU2119 DVU2121 DVU2123 DVU2124 DVU2126 DVU2127 DVU2281 DVU2410 DVU2524 DVU2526 DVU2626 DVU2679 DVU3062 DVU3107 DVU3131 DVU3133 DVU3134 DVU3143 DVU3144 DVU3156 DVU3246 DVU3247 DVU3248 | cheW-1 sodB hynA-2 glpK glmS | response regulator | sensory box histidine kinase, putative | methyl-accepting chemotaxis protein | chemotaxis protein CheW | hypothetical protein | type II/III secretion system protein | von Willebrand factor type A domain protein | sensor histidine kinase/response regulator | superoxide dismutase, Fe | cytochrome c3, putative | periplasmic [NiFe] hydrogenase, large subunit, isozyme 2 | sensory box histidine kinase/response regulator | cytochrome c family protein | transcriptional regulator, putative | glycerol uptake facilitator protein | glycerol kinase | iron-sulfur cluster-binding protein | glucosamine--fructose-6-phosphate aminotransferase (isomerizing) | RND efflux system, outer membrane protein, NodT family | efflux transporter, RND family, MFP subunit | AcrB/AcrD/AcrF family protein |
322 | 18 | 373 | -39.819 | 0.524 | Residual = 0.524 | | tATgaTGgaTttacnATgtTaAT | AAacTGTATCA | | DVU0457 DVU1103 DVU1104 DVU1127 DVU1131 DVU1550 DVU1551 DVU1553 DVU1555 DVU1556 DVU1557 DVU1558 DVU1560 DVU1562 DVU1970 DVU2596 DVU2698 DVUA0151 | | EAL domain protein | baseplate assembly protein, putative | hypothetical protein | phosphoglycerate mutase family protein | HD domain protein | AMP-binding protein | cysteine-rich domain/iron-sulfur cluster-binding domain protein | molybdopterin biosynthesis protein, putative | HAMP domain protein | response regulator | lipoprotein, putative | DNA-binding protein, putative |
323 | 19 | 371 | -46.982 | 0.486 | Residual = 0.486 | | CCGgAnACaCGgGCG | aTgtCCaGAcAaGgtgaTgggtG | | DVU0064 DVU0732 DVU1025 DVU1089 DVU1090 DVU1205 DVU1206 DVU1220 DVU1293 DVU1615 DVU1616 DVU1617 DVU1618 DVU1619 DVU1620 DVU1819 DVU2586 DVU2890 DVU3065 | valS upp alaS recA acpP fabG paaK-2 gpmA secD | hypothetical protein | valyl-tRNA synthetase | uracil phosphoribosyltransferase | alanyl-tRNA synthetase | recombinase A | acyl carrier protein | 3-oxoacyl-(acyl-carrier-protein) reductase | nitroreductase family protein | phenylacetate-coenzyme A ligase | iojap-related protein | phosphoglyceromutase | preprotein translocase subunit SecD | putative ABC transporter ATP-binding protein | acyl-CoA synthetase |
324 | 15 | 358 | -60.616 | 0.411 | Residual = 0.411 | | gGCAAcgTgAaaAaAcAACgtCAA | ATTCgaGGtGTCTTG | | DVU0484 DVU0539 DVU1233 DVU1562 DVU1563 DVU2598 DVU2600 DVU2623 DVU2624 DVU2702 DVU2703 DVU2721 DVU2722 DVU2723 DVU2729 | | ABC transporter, ATP-binding protein | sigma-54 dependent DNA-binding response regulator | protein-P-II uridylyltransferase, putative | HAMP domain protein | sensory box histidine kinase/response regulator | hypothetical protein | phage tail tape measure protein, TP901 family, putative | tail protein, putative |
325 | 10 | 366 | -89.485 | 0.296 | Residual = 0.296 | |
|
| | DVU1119 DVU1308 DVU1309 DVU1311 DVU1312 DVU1316 DVU1317 DVU1318 DVU1319 DVU1320 | rplV rpsC rpmC rpsQ rpsN rpsH rplF rplR rpsE | virion morphogenesis protein | 50S ribosomal protein L22 | 30S ribosomal protein S3 | 50S ribosomal protein L29 | 30S ribosomal protein S17 | 30S ribosomal protein S14 | 30S ribosomal protein S8 | 50S ribosomal protein L6 | 50S ribosomal protein L18 | 30S ribosomal protein S5 |
326 | 19 | 364 | -27.937 | 0.523 | Residual = 0.523 | | ACCTCCATGa | ACCtggAgcaCatCCtcat | | DVU0306 DVU0488 DVU1034 DVU1226 DVU1297 DVU1400 DVU1610 DVU1846 DVU1885 DVU1981 DVU2025 DVU2149 DVU2237 DVU2476 DVU2628 DVU2656 DVU2753 DVU2773 DVU2939 | purD nadE pgsA gatB gltA | hypothetical protein | phosphoribosylamine--glycine ligase | methyl-accepting chemotaxis protein | glutamine-dependent NAD+ synthetase | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase | aspartyl/glutamyl-tRNA amidotransferase subunit B | nucleotide-binding protein | cobalamin biosynthesis protein CobD, putative | putative oxidoreductase | TPR domain protein | C_GCAxxG_C_C family protein |
327 | 20 | 365 | -45.173 | 0.417 | Residual = 0.417 | | GgTTTTC | GnAtCCcggAAccG | | DVU0021 DVU0091 DVU0327 DVU0336 DVU0340 DVU0451 DVU1056 DVU1276 DVU1347 DVU1611 DVU1772 DVU2367 DVU2558 DVU2757 DVU2942 DVU3167 DVU3168 DVU3174 DVU3175 DVU3239 | lpxA bioB purB hemL ubiE | hypothetical protein | exopolysaccharide biosynthesis protein, putative | aminotransferase, DegT/DnrJ/EryC1/StrS family | acetyltransferase, CysE/LacA/LpxA/NodL family | chloride channel family protein | cobalt ABC transporter, ATP-binding protein, putative | peptidase, M23/M37 family | molybdopterin oxidoreductase domain protein | pyridine nucleotide-disulfide oxidoreductase | UDP-N-acetylglucosamine acyltransferase | biotin synthase | radical SAM domain protein | adenylosuccinate lyase | heme biosynthesis protein, putative | glutamate-1-semialdehyde-2,1-aminomutase | ubiquinone/menaquinone biosynthesis methlytransferase UbiE | PAP2 family protein |
328 | 9 | 372 | -96.463 | 0.344 | Residual = 0.344 | | cGtCGAAggTccGgCaCgcG | CGcCCcTGAC | | DVU0215 DVU2731 DVUA0013 DVUA0015 DVUA0039 DVUA0040 DVUA0042 DVUA0051 DVUA0065 | glnB-2 nifH | tail protein, putative | tail fiber assembly protein, putative | nitrogen regulatory protein P-II | nitrogenase reductase | chain length determinant family protein | polysaccharide biosynthesis protein, putative | lipoprotein, putative | glycosyl transferase, group 1 family protein | sensor histidine kinase |
329 | 15 | 374 | -48.667 | 0.428 | Residual = 0.428 | | ATGGCgcAAGG | gCaTcgaGCtT | | DVU0181 DVU0183 DVU0283 DVU0442 DVU1416 DVU1698 DVU1714 DVU2271 DVU2334 DVU2346 DVU2540 DVU2541 DVU2656 DVUA0048 DVUA0057 | modB | molybdenum ABC transporter, permease protein | methyl-accepting chemotaxis protein | AhpF family protein/thioredoxin reductase | phoH-related protein | hypothetical protein | pyruvate formate-lyase activating enzyme, putative | 2-hydroxyglutaryl-CoA dehydratase, D-component | CoA-substrate-specific enzyme activase, putative | exopolysaccharide production protein, putative | sigma-54 dependent transcriptional regulator/response regulator |
330 | 25 | 357 | -25.191 | 0.583 | Residual = 0.583 | | tcGataTaaccTCgcCtnT | GcAGGCAa | | DVU0301 DVU0528 DVU0711 DVU0947 DVU1165 DVU1279 DVU1280 DVU1605 DVU1606 DVU1607 DVU1627 DVU1630 DVU1631 DVU1632 DVU1633 DVU1634 DVU2058 DVU2085 DVU2265 DVU2316 DVU2693 DVU2699 DVU3122 DVU3343 DVU3380 | folP uvrB topB | hypothetical protein | phosphatidylglycerophosphatase | pyridine nucleotide-disulfide oxidoreductase | dihydropteroate synthase | conserved hypothetical protein TIGR00159 | excinuclease ABC subunit B | potassium uptake protein, TrkA family | ABC transporter, ATP-binding protein | PTS system, IIA component | PTS system, IIB component | HDIG domain protein | Snf2 family protein | DNA topoisomerase III | transglycosylase SLT domain protein |
331 | 23 | 364 | -27.779 | 0.603 | Residual = 0.603 | | aaaTGACtAaAAaGaGTaTaTA | CGTccaTAtCaatCcAcAGnTtcC | | DVU0073 DVU0293 DVU0428 DVU0605 DVU0645 DVU0712 DVU0714 DVU0715 DVU0716 DVU0875 DVU0902 DVU0925 DVU1014 DVU1108 DVU1109 DVU1479 DVU1661 DVU1746 DVU1833 DVU1837 DVU2452 DVU2617 DVU3288 | rfbA | CDP-glucose-4,6-dehydratase, putative | prokaryotic dksA/traR C4-type zinc finger family protein | hypothetical protein | methyl-accepting chemotaxis protein | amino acid ABC transporter, periplasmic-binding protein | branched-chain amino acid ABC transporter, permease protein | branched-chain amino acid ABC transporter, ATP binding protein | branched-chain amino acid ABC transporter, ATP-binding protein | fumarylacetoacetate hydrolase family protein | TPR domain protein | glucose-1-phosphate thymidylyltransferase | ATPase domain protein | C-5 cytosine-specific DNA methylase family protein | phosphoenolpyruvate synthase, putative | competence protein, putative | sodium/calcium exchanger family protein |
332 | 23 | 361 | -24.462 | 0.547 | Residual = 0.547 | | tctTTtcgTTT | GggtGccgTTG | | DVU0302 DVU0674 DVU0690 DVU0789 DVU0925 DVU0939 DVU1409 DVU1572 DVU1631 DVU1633 DVU1634 DVU1679 DVU1801 DVU1832 DVU1837 DVU1845 DVU1894 DVU2308 DVU2354 DVU2532 DVU3117 DVU3226 DVU3228 | mreB-1 rfbA idi cheY-3 | chemotaxis protein CheX, putative | ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | hypothetical protein | rod shape-determining protein MreB | glucose-1-phosphate thymidylyltransferase | transcriptional regulator, CarD family | PTS system, IIB component | isopentenyl-diphosphate delta-isomerase | competence protein, putative | conserved hypothetical protein TIGR00022 | glycosyl transferase, group 2 family protein | transcriptional regulator, MerR family | chemotaxis protein CheY |
333 | 9 | 369 | -96.878 | 0.275 | Residual = 0.275 | |
|
| | DVU1119 DVU1310 DVU1311 DVU1312 DVU1313 DVU1316 DVU1317 DVU1318 DVU1319 | rplP rpmC rpsQ rplN rpsN rpsH rplF rplR | virion morphogenesis protein | 50S ribosomal protein L16 | 50S ribosomal protein L29 | 30S ribosomal protein S17 | 50S ribosomal protein L14 | 30S ribosomal protein S14 | 30S ribosomal protein S8 | 50S ribosomal protein L6 | 50S ribosomal protein L18 |
334 | 38 | 365 | -29.876 | 0.557 | Residual = 0.557 | | tTgTtAagGaCTTctCATCgcTG | acCCcGcCTtGnCGcnCGtcAGC | | DVU0103 DVU0124 DVU0154 DVU0194 DVU0297 DVU0362 DVU0363 DVU0446 DVU0651 DVU1036 DVU1081 DVU1150 DVU1459 DVU1460 DVU1461 DVU1463 DVU1465 DVU1903 DVU2276 DVU2279 DVU2280 DVU2843 DVU2844 DVU2885 DVU2888 DVU2908 DVU2949 DVU2954 DVU2955 DVU3043 DVU3072 DVU3096 DVU3115 DVU3233 DVU3297 DVU3320 DVU3343 DVUA0103 | pabB hemA mfd flhB invX | cation ABC transporter, ATP-binding protein, putative | hypothetical protein | terminase, large subunit, putative | para-aminobenzoate synthase, component I | sodium/solute symporter family protein | iron-sulfur cluster-binding protein | glutamyl-tRNA reductase | siroheme synthase, N-terminal domain protein | CgeB family protein | transcription-repair coupling factor | amino acid permease family protein | DNA mismatch endonuclease Vsr, putative | alcohol dehydrogenase, iron-containing | cobalt ABC transporter, ATP-binding protein, putative | GGDEF domain protein | ABC transporter, permease protein, putative | flagellar biosynthesis protein FlhB | tryptophan-specific transport protein | type III secretion protein, HrpO family |
335 | 12 | 365 | -89.771 | 0.323 | Residual = 0.323 | | TgcgGCAtCTtCGGC | CaACTACA | | DVU2846 DVUA0010 DVUA0012 DVUA0015 DVUA0024 DVUA0037 DVUA0041 DVUA0043 DVUA0051 DVUA0064 DVUA0090 DVUA0152 | nifD nifH | hypothetical protein | ferredoxin, 2fe-2s | nitrogenase molybdenum-iron protein alpha chain | nitrogenase reductase | sigma-54 interaction domain protein | sugar transferase domain protein | polysaccharide deacetylase family protein | glycosyl transferase, group 1 family protein |
336 | 16 | 368 | -60.801 | 0.388 | Residual = 0.388 | | ATcGTGctTTc | TTcTATgttTTCAATtTAT | | DVU0506 DVU0787 DVU0788 DVU0967 DVU0968 DVU1532 DVU1671 DVU1673 DVU1776 DVU1935 DVU2036 DVU2374 DVU2375 DVU3069 DVU3164 DVU3165 | mreC coaD lolD | DHH family protein | hypothetical protein | rod shape-determining protein MreC | amino acid ABC transporter, permease protein, His/Glu/Gln/Arg/opine family | amino acid ABC transporter, ATP-binding protein | pantetheine-phosphate adenylyltransferase | ABC transporter, ATP-binding protein/permease protein | acyltransferase, putative | phosphonate ABC transporter, permease protein | helix-turn-helix protein, CopG family | lipoprotein releasing system, ATP-binding protein | lipoprotein releasing system, permease protein | conserved hypothetical protein TIGR00247 | ABC transporter, permease protein |
337 | 24 | 368 | -27.313 | 0.540 | Residual = 0.540 | | AAGCCTcGaaG | CAAAAGgA | | DVU0073 DVU0184 DVU0474 DVU0767 DVU1266 DVU1567 DVU1599 DVU1669 DVU1844 DVU1845 DVU1944 DVU1945 DVU1946 DVU1947 DVU1948 DVU2048 DVU2049 DVU2435 DVU2582 DVU3173 DVU3275 DVU3277 DVUA0073 DVUA0075 | crcB rluB glutamine-hydrolyzing | CDP-glucose-4,6-dehydratase, putative | hypothetical protein | ISDvu4, transposase | aminotransferase, class V | crcB protein | ribosomal large subunit pseudouridine synthase B | septum formation initiator family protein | pyruvate ferredoxin oxidoreductase, iron-sulfur binding subunit, putative | 2-oxoglutarate ferredoxin oxidoreductase subunit alpha | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | pyruvate ferredoxin oxidoreductase, gamma subunit, putative | transporter, CorA family | transcriptional regulator, TetR family | asparagine synthase (glutamine-hydrolyzing), putative | radical SAM domain protein |
338 | 14 | 372 | -67.827 | 0.391 | Residual = 0.391 | | GATtGCCt | AGaGAAG | | DVU1053 DVU1488 DVU1494 DVU1495 DVU1496 DVU1497 DVU1498 DVU1499 DVU1500 DVU1501 DVU1514 DVU1522 DVU1523 DVU1524 | | hypothetical protein | minor tail protein, putative | head-tail adaptor, putative | major capsid protein, HK97 family | ClpP protease family protein |
339 | 20 | 366 | -53.588 | 0.436 | Residual = 0.436 | | cAAngaaanTtaaaA | atTTtgtTgtGtTgA | | DVU0371 DVU0554 DVU0555 DVU0556 DVU0557 DVU0558 DVU0559 DVU0561 DVU0562 DVU0923 DVU1147 DVU1166 DVU1167 DVU1277 DVU1832 DVU2010 DVU2048 DVU2175 DVU2827 DVU3089 | | hypothetical protein | NAD-dependent epimerase/dehydratase family protein | ISDvu3, transposase OrfA | lipoprotein, putative | glycosyl transferase, group 1 family protein | ISD1, transposase OrfA | endoribonuclease, L-PSP family | alginate o-acetyltransferase AlgI, putative | ISD1, transposase OrfB | adenine specific DNA methyltransferase, putative | sigma-54 dependent transcriptional regulator |
340 | 17 | 373 | -61.264 | 0.495 | Residual = 0.495 | | AaAAacAnaaGGTTAAAGAAAGaA | ACTGAACCTCCCAATATCCCTGAA | | DVU0190 DVU0191 DVU0192 DVU0193 DVU1724 DVU2854 DVU2878 DVU2879 DVU2880 DVUA0034 DVUA0038 DVUA0054 DVUA0058 DVUA0060 DVUA0139 DVUA0140 DVUA0152 | | hypothetical protein | adenine specific DNA methyltransferase, putative | phage uncharacterized protein, putative | tail protein, putative | capsular polysaccharide transport protein | glycosyl transferase, group 1 family protein | BNR/Asp-box repeat protein | outer membrane autotransporter barrel domain protein |
341 | 28 | 374 | -37.127 | 0.483 | Residual = 0.483 | | CcTtgCCTtTGtCgT | CacatGgaacGCatGAcggtgCCC | | DVU0009 DVU0067 DVU0102 DVU0351 DVU0381 DVU0448 DVU1035 DVU1128 DVU1129 DVU1239 DVU1446 DVU1451 DVU1508 DVU1810 DVU1858 DVU2277 DVU2283 DVU2336 DVU2855 DVU2871 DVU2874 DVU2992 DVU3081 DVU3108 DVU3110 DVU3267 DVU3325 DVUA0096 | nhaC-1 gmd nhaC-2 | TRAP transporter, DctM subunit | hypothetical protein | cation ABC transporter, periplasmic binding protein | cytidine 5'monophosphate N-acetylneuraminic acid synthetase, putative/polysaccharide biosynthesis protein | Na+/H+ antiporter NhaC | GDP-mannose 4,6-dehydratase | glucokinase, putative | lysozyme, putative | heptosyltransferase family protein | response regulator | cold shock domain protein | carboxyl-terminal protease | tail/DNA circulation protein, putative | minor capsid protein C | glycosyl transferase, group 2 family protein | major facilitator superfamily protein |
342 | 29 | 370 | -37.128 | 0.588 | Residual = 0.588 | | CAAGCggCgTCTGTacgGCtaaCG | TTTgATttaGGTTTCAgGCATG | | DVU0411 DVU0547 DVU1360 DVU2067 DVU2068 DVU2162 DVU2384 DVU2385 DVU2386 DVU2387 DVU2394 DVU2395 DVU2396 DVU2397 DVU2398 DVU2399 DVU2400 DVU2401 DVU2402 DVU2403 DVU2404 DVU2405 DVU2406 DVU2453 DVU2454 DVU2455 DVU2459 DVU2498 DVU2551 | galE hdrA hdrB hdrC | heptosyltransferase family protein | high-affinity branched chain amino acid ABC transporter, periplasmic branched chain amino acid-binding protein | UDP-glucose 4-epimerase | GGDEF domain protein | HD domain protein | hypothetical protein | ABC transporter, periplasmic substrate-binding protein | ABC transporter, permease protein | ABC transporter, ATP-binding protein | sigma-54 dependent transcriptional regulator/response regulator | sensor histidine kinase | alcohol dehydrogenase, iron-containing | hydrogenase, putative | hydrogenase, iron-sulfur cluster-binding subunit, putative | heterodisulfide reductase, A subunit | heterodisulfide reductase, B subunit | heterodisulfide reductase, C subunit | NAD-dependent epimerase/dehydratase family protein |
343 | 18 | 367 | -54.410 | 0.428 | Residual = 0.428 | | TnAnAtActcgAtaatgtTGT | CAgTAgtaTaCgcAaaATaTCAa | | DVU0056 DVU0074 DVU0222 DVU0259 DVU0267 DVU0268 DVU0281 DVU0945 DVU1190 DVU1470 DVU1762 DVU1796 DVU2227 DVU2443 DVU2847 DVU3039 DVU3182 DVU3375 | cheV-1 ppiC dcrA | chemotaxis protein CheV | polysaccharide biosynthesis domain protein | hypothetical protein | DNA-binding response regulator | exopolysaccharide biosynthesis protein, putative | sensor histidine kinase | sensory box/GGDEF domain/EAL domain protein | peptidyl-prolyl cis-trans isomerase C | methyl-accepting chemotaxis protein DcrA | cell division ATP-binding protein FtsE, putative |
344 | 20 | 368 | -39.649 | 0.457 | Residual = 0.457 | | TaCAACCtnTgGgAAAAgGAg | TTTTAAaAAAA | | DVU0014 DVU0764 DVU0784 DVU0841 DVU0968 DVU1008 DVU1025 DVU1026 DVU1092 DVU1260 DVU1290 DVU1323 DVU2032 DVU2033 DVU2035 DVU2682 DVU2696 DVU2697 DVU2901 DVU3210 | infA-1 hup-2 upp uraA secY pyrB thrC | translation initiation factor IF-1 | DNA-binding protein HU | hypothetical protein | aspartate aminotransferase | amino acid ABC transporter, ATP-binding protein | uracil phosphoribosyltransferase | uracil permease | sodium-dependent symporter family protein | outer membrane protein P1, putative | nitrate reductase, gamma subunit, putative | preprotein translocase subunit SecY | ERF family protein | plasmid stabilization system family protein | DedA family protein | aspartate carbamoyltransferase catalytic subunit | threonine synthase |
345 | 10 | 367 | -37.395 | 0.506 | Residual = 0.506 | | CCgtTTC | TGttGCgggcATGatcgtcGaTGC | | DVU0479 DVU0538 DVU1068 DVU1080 DVU1156 DVU2095 DVU2424 DVU2758 DVU2786 DVUA0129 | thiS cas3 | serine/threonine protein kinase, putative | AP endonuclease, family 2 | branched-chain amino acid ABC transporter, permease protein | iron-sulfur cluster-binding protein | sigma-54 dependent transcriptional regulator, putative/response regulator | thiamine biosynthesis protein ThiS | hypothetical protein | CRISPR-associated helicase Cas3 domain protein |
346 | 26 | 377 | -44.147 | 0.523 | Residual = 0.523 | | TtGatAtTcattTCACAA | ATTTTcTg | | DVU0259 DVU0260 DVU0261 DVU0262 DVU0263 DVU0264 DVU0265 DVU0266 DVU0267 DVU0269 DVU0270 DVU0778 DVU2287 DVU2290 DVU2292 DVU2293 DVU2957 DVU2958 DVU2959 DVU2960 DVU2962 DVU2963 DVU2964 DVU2966 DVU2967 DVU3353 | atpH hypA cooF coaBC | DNA-binding response regulator | response regulator | universal stress protein family | hypothetical protein | acidic cytochrome c3 | ferredoxin, 4Fe-4S, putative | transcriptional regulator, rrf2 protein, putative | sensory box histidine kinase | ATP synthase, F1 delta subunit | hydrogenase, CooK subunit, selenocysteine-containing, putative | hydrogenase, CooU subunit, putative | hydrogenase nickel insertion protein HypA | iron-sulfur protein CooF | sigma-54 dependent transcriptional regulator | sensor histidine kinase | sensor histidine kinase/response regulator | phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase |
347 | 18 | 371 | -50.437 | 0.444 | Residual = 0.444 | | ATTgaCAgAATTGATATATA | TacCaGAAAg | | DVU0165 DVU0166 DVU0167 DVU0168 DVU0279 DVU0384 DVU0390 DVU0548 DVU0549 DVU0550 DVU0551 DVU0713 DVU0714 DVU1245 DVU1291 DVU2341 DVUA0069 DVUA0070 | flr | oligopeptide/dipeptide ABC transporter, ATP-binding protein | oligopeptide/dipeptide ABC transporter, permease protein | sulfate permease family protein | flavoredoxin | glycolate oxidase, subunit GlcD, putative | high-affinity branched-chain amino acid ABC transporter, permease protein | high-affinity branched-chain amino acid ABC transporter, ATP binding protein | high-affinity branched-chain amino acid ABC transporter ATP-binding protein | branched-chain amino acid ABC transporter, permease protein | ABC transporter, ATP-binding protein | hypothetical protein | amino acid ABC transproter, permease protein, His/Glu/Gln/Arg/opine family | GtrA family protein, selenocysteine-containing |
348 | 36 | 370 | -30.986 | 0.560 | Residual = 0.560 | | CTTTcCcGCCGTCCcGACgTCGGA | cTgaCntCCATaaCgGTctggtac | | DVU0019 DVU0092 DVU0175 DVU0260 DVU0263 DVU0264 DVU0402 DVU0403 DVU0404 DVU0701 DVU0979 DVU0980 DVU1179 DVU1681 DVU1684 DVU1685 DVU1686 DVU1917 DVU1918 DVU1921 DVU1922 DVU2109 DVU2481 DVU2482 DVU2483 DVU2514 DVU2557 DVU3037 DVU3183 DVU3184 DVU3185 DVU3262 DVU3263 DVU3293 DVU3294 DVU3319 | ngr dsvA dvsB glcB aor mreB-2 gcvT hysB hysA hynB-1 hynA-1 fdnG-2 pyk birA rbO roO fdrA sdhB NADP putA | nigerythrin | sensory box histidine kinase | tungsten formylmethanofuran dehydrogenase family protein/molybdopterin binding protein | response regulator | acidic cytochrome c3 | ferredoxin, 4Fe-4S, putative | dissimilatory sulfite reductase alpha subunit | dissimilatory sulfite reductase beta subunit | dissimilatory sulfite reductase B | malate synthase G | dihydroxyacetone kinase subunit DhaK | DAK2 domain protein | aldehyde:ferredoxin oxidoreductase, tungsten-containing | rod shape-determining protein MreB | glycine cleavage system T protein | conserved hypothetical protein TIGR00046 | recombination factor protein RarA | periplasmic [NiFeSe] hydrogenase, small subunit | periplasmic [NiFeSe] hydrogenase, large subunit, selenocysteine-containing | periplasmic [NiFe] hydrogenase, small subunit, isozyme 1 | periplasmic [NiFe] hydrogenase, large subunit, isozyme 1 | hypothetical protein | formate dehydrogenase, beta subunit, putative | formate dehydrogenase, alpha subunit, selenocysteine-containing | cytochrome c family protein | pyruvate kinase | birA bifunctional protein | rhodanese-like domain protein | desulfoferrodoxin | rubredoxin | rubredoxin-oxygen oxidoreductase | fumarate reductase | succinate dehydrogenase iron-sulfur subunit | acetolactate synthase | aldehyde dehydrogenase (NADP) family protein | proline dehydrogenase/delta-1-pyrroline-5-carboxylate dehydrogenase |
349 | 1 | 361 | -139.503 | 1.000 | Residual = 1.000 | |
|
| | DVU2768 | | comF family protein |