| bicluster | n.genes | n.arrays | score | residual | profile | network | motif1 | motif2 | motif.posns | probe.names | short.names | long.names |
| 1 | 29 | 37 | -10.862 | 0.424 | 
Residual = 0.424 |  | 
CgACCCccgagG | 
CCGCTg |  | Antisense_2 Antisense_23 Antisense_5 MMP0119 MMP0153 MMP0154 MMP0166 MMP0167 MMP0168 MMP0176 MMP0180 MMP0239 MMP0450 MMP0451 MMP0536 MMP0608 MMP0685 MMP0876 MMP1071 MMP1072 MMP1140 MMP1185 MMP1238 MMP1240 MMP1241 MMP1549 MMP1550 MMP1605 MMP1606 | Antisense_1 birA aksA drug/sodium antiporters ribC Component A and some other nucleotide cofG subgroup I fdxA bioB | Biotin--protein ligase | trans-homoaconitate synthase | hypothetical protein | MatE family member (drug/sodium antiporters) | ABC transporter ATP binding protein family member | Transcriptional regulator PadR-like family | CDC48 cell division cycle protein family member | riboflavin synthase | ferredoxin | 2-hydroxyglutaryl-CoA dehydratase (Component A) related protein | SAM (and some other nucleotide) binding motif:N-6 Adenine-specific DNA methylase | FO synthase subunit 1 | Aminotransferase (subgroup I) similar to Aromatic Aminotransferase | Hydrogen uptake protein:Hydrogenase maturation protease HycI | TonB-dependent receptor protein:Biotin synthase | Sep-tRNA:Cys-tRNA synthetase | AP endonuclease, family 2 | NADP oxidoreductase, coenzyme F420-dependent | Pyruvate kinase | Flavoprotein:DNA/pantothenate metabolism flavoprotein |
| 2 | 15 | 40 | -23.134 | 0.197 | 
Residual = 0.197 |  | 
tAGGGGGAgt | 
GAGcTntgAGcCcAA |  | Antisense_10 MMP0102 MMP0115 MMP0182 MMP0305 MMP0306 MMP0600 MMP0720 MMP0785 MMP0863 MMP1012 MMP1059 MMP1331 MMP1332 MMP1338 | pcm dop exoA | Protein-L-isoaspartate(D-aspartate) O-methyltransferase | hypothetical protein | 2-oxoacid ferredoxin oxidoreductase subunit beta | oxidoreductase family member subunit alpha | hydroxylamine reductase | Chymotrypsin serine protease, family S1 | CBS domain | exonuclease III | NAD binding site:FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
| 3 | 11 | 39 | -25.184 | 0.133 | 
Residual = 0.133 |  | 
AAgCGTgC | 
GGAGGAAg |  | MMP0442 MMP0443 MMP0444 MMP0667 MMP0668 MMP0669 MMP1289 MMP1402 MMP1403 MMP1404 MMP1405 | rps24e rps2P rpl10e rpl22p rps3p rpmC | hypothetical protein | 30S ribosomal protein S24e | 30S ribosomal protein S27ae | 30S ribosomal protein S2 | 30S ribosomal protein S3Ae | 50S ribosomal protein L10e | 50S ribosomal protein L22P | 30S ribosomal protein S3P | 50S ribosomal protein L29 |
| 4 | 36 | 38 | -9.704 | 0.534 | 
Residual = 0.534 |  | 
GTGtGCtccCAac | 
GGGggAACc |  | MMP0011 MMP0105 MMP0140 MMP0181 MMP0216 MMP0243 MMP0296 MMP0333 MMP0392 MMP0401 MMP0412 MMP0447 MMP0448 MMP0479 MMP0503 MMP0524 MMP0525 MMP0571 MMP0886 MMP0948 MMP0949 MMP1000 MMP1064 MMP1130 MMP1150 MMP1228 MMP1303 MMP1304 MMP1305 MMP1307 MMP1645 MMP1698 RNA_17 Unanno_23 Unanno_27 Unanno_51 | purD metE moaA RNA recognition motif mtaA tRNA-Pro2 | C-5 cytosine-specific DNA methylase | hypothetical protein | cation transport ATPase | Phosphoribosylamine--glycine ligase | methionine synthase | nitrogenase related protein | molybdenum cofactor biosynthesis protein A | cobalt transport system permease related protein | tRNA CCA-pyrophosphorylase | RNA-binding region RNP-1 (RNA recognition motif):Adenylate cyclase | Uroporphyrinogen decarboxylase (URO-D) | Sensory transduction histidine kinase | Response regulator receiver | methyltransferase related protein | amino acid kinase related protein | tRNA-Pro |
| 5 | 25 | 41 | -12.803 | 0.378 | 
Residual = 0.378 |  | 
ACCacC | 
TCcTtgaGATgTTagGGA |  | Antisense_24 MMP0114 MMP0478 MMP0490 MMP0491 MMP0492 MMP0508 MMP0511 MMP0552 MMP0673 MMP0674 MMP0675 MMP0700 MMP0743 MMP0744 MMP0745 MMP0746 MMP0747 MMP0748 MMP0749 MMP0750 MMP0752 MMP0960 MMP1055 MMP1649 | fmdE fmdB modC | hypothetical protein | MotA/TolQ/ExbB proton channel | molybdenum containing formylmethanofuran dehydrogenase, subunit E | molybdenum containing formylmethanofuran dehydrogenase, subunit B | TPR repeat | Helix-turn-helix DNA binding protein | transcriptional regulator PadR-like family | Probable integrase/recombinase | MCM family related protein | ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase:TOBE domain |
| 6 | 17 | 38 | -22.297 | 0.185 | 
Residual = 0.185 |  | 
AATTTTAGAgg | 
CCCTtCCG |  | MMP0110 MMP0195 MMP0196 MMP0197 MMP0339 MMP0436 MMP0437 MMP0461 MMP0515 MMP0519 MMP0740 MMP0766 MMP0832 MMP0847 MMP1172 MMP1276 MMP1571 | III rimK modB resP | ABC transporter:AAA ATPase | hypothetical protein | ABC-type iron(III) transport system, periplasmic binding protein | ABC-type iron(III) transport system, permease component | NUDIX hydrolase | putative SSU ribosomal protein S6 modification protein | Molybdenum ABC transporter, permease protein | possible purine NTPase | Site-specific recombinase |
| 7 | 28 | 38 | -15.722 | 0.315 | 
Residual = 0.315 |  | 
GGTGgaA | 
cAGtTAGgTTAgTTCgAgTaGT |  | MMP0080 MMP0282 MMP0308 MMP0318 MMP0326 MMP0345 MMP0346 MMP0359 MMP0408 MMP0539 MMP0541 MMP0666 MMP0696 MMP0708 MMP0893 MMP0947 MMP1018 MMP1105 MMP1146 MMP1266 MMP1315 MMP1316 MMP1352 MMP1470 MMP1587 MMP1588 MMP1589 MMP1615 | purE ilvD metG Component D leuB serB proS pyrG hisG cimA sucC purF Gln korG korB pdfA serA carA | glutamate synthase; large subunit; archaeal subunit 1 | phosphoribosylaminoimidazole carboxylase catalytic subunit | hypothetical protein | Dihydroxy-acid dehydratase | methionyl-tRNA synthetase | 2-hydroxyglutaryl-CoA dehydratase (Component D) related protein | Glycosyl transferase, family 2 | H+-transporting two-sector ATPase, A subunit | 3-isopropylmalate dehydrogenase | Phosphoserine phosphatase | Na+/Pi-cotransporter related protein | prolyl-tRNA synthetase | CTP synthetase | ATP phosphoribosyltransferase | (R)-citramalate synthase | succinate-CoA ligase (ADP-forming), beta chain | Amidophosphoribosyltransferase | glutamyl-tRNA(Gln) amidotransferase subunit D | 2-oxoglutarate ferredoxin oxidoreductase subunit gamma | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | putative thiazole biosynthetic enzyme | Prefoldin alpha subunit (GimC alpha subunit). | D-3-phosphoglycerate dehydrogenase | carbamoyl phosphate synthase small subunit |
| 8 | 52 | 36 | -7.038 | 0.537 | 
Residual = 0.537 |  | 
gCCGCaGGTTCaacTcCCcCTCcC | 
aGGTGATTTT |  | MMP0025 MMP0059 MMP0061 MMP0093 MMP0094 MMP0103 MMP0116 MMP0127 MMP0183 MMP0242 MMP0290 MMP0309 MMP0371 MMP0382 MMP0407 MMP0414 MMP0539 MMP0540 MMP0597 MMP0629 MMP0645 MMP0650 MMP0651 MMP0657 MMP0687 MMP0697 MMP0704 MMP0736 MMP0737 MMP0816 MMP0898 MMP0946 MMP0965 MMP0971 MMP1021 MMP1023 MMP1070 MMP1213 MMP1308 MMP1321 MMP1352 MMP1512 MMP1513 MMP1527 MMP1531 MMP1588 MMP1656 MMP1698 MMP1705 Unanno_15 Unanno_17 Unanno_8 | aIF6 argC hmd ribB nac thrS leuB purC flpA mdh ilvB ilvH tpiA leuS gatB purB tal rps11p alr ald serA Unanno_1 | hypothetical protein | translation initiation factor IF-6 | 50S ribosomal protein L21e | pyridoxine biosynthesis protein | N-acetyl-gamma-glutamyl-phosphate reductase | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase | 3,4-dihydroxy-2-butanone 4-phosphate synthase | nascent polypeptide-associated complex protein | intracellular sulfur reduction related protein | putative ATPase RIL | threonyl-tRNA synthetase | 3-isopropylmalate dehydrogenase | phosphoribosylaminoimidazole-succinocarboxamide synthase | fibrillarin | malate dehydrogenase | acetolactate synthase catalytic subunit | acetolactate synthase 3 regulatory subunit | triosephosphate isomerase | leucyl-tRNA synthetase | ParA type ATPase | L-aspartate dehydrogenase | bacterial seryl-tRNA synthetase related | Cellulose-binding, bacterial type | aspartyl/glutamyl-tRNA amidotransferase subunit B | formylmethanofuran dehydrogenase subunit E related protein | adenylosuccinate lyase | Transcriptional regulator, TetR Family Member | putative translaldolase | 30S ribosomal protein S11P | putative thiazole biosynthetic enzyme | Alanine racemase | alanine dehydrogenase | aspartate aminotransferase | D-3-phosphoglycerate dehydrogenase | putative pyridoxine biosynthetic glutamine amidotransferase |
| 9 | 28 | 39 | -12.912 | 0.441 | 
Residual = 0.441 |  | 
TGaCtGATTAgTCAA | 
GGtttTgTGggtagcAc |  | Antisense_22 MMP0057 MMP0138 MMP0139 MMP0172 MMP0347 MMP0486 MMP0791 MMP0792 MMP0793 MMP0799 MMP0818 MMP0819 MMP0822 MMP0824 MMP1053 MMP1054 MMP1297 MMP1298 MMP1299 MMP1300 MMP1301 MMP1302 MMP1378 MMP1642 Unanno_18 Unanno_45 Unanno_50 | cofH fdhA fdhB frcG frcD vhcG vhcB hdrB2 hdrC2 fdhC P-loop | FO synthase subunit 2 | formate dehydrogenase alpha subunit | formate dehydrogenase beta subunit | hypothetical protein | Transcriptional regulator, TetR Family Member | membrane protein | coenzyme F420-reducing hydrogenase subunit gamma | coenzyme F420-reducing hydrogenase subunit delta | coenzyme F420-non-reducing hydrogenase subunit gamma | coenzyme F420-non-reducing hydrogenase subunit beta | heterodisulfide reductase; subunit B2 | heterodisulfide reductase; subunit C2 | carbonic anhydrase | Formate transporter | ATP/GTP-binding site motif A (P-loop):Small GTP-binding protein domain |
| 10 | 25 | 42 | -29.016 | 0.234 | 
Residual = 0.234 |  | 
cTAtTTATCATgATtgATAATgA | 
CTAACGGTGg |  | MMP0984 MMP0985 MMP1152 MMP1153 MMP1271 MMP1272 MMP1273 MMP1274 MMP1275 MMP1469 MMP1502 MMP1503 MMP1504 MMP1505 MMP1506 MMP1507 MMP1621 MMP1622 MMP1623 MMP1624 MMP1625 MMP1626 MMP1627 MMP1628 MMP1629 | cdh cdhA ehbN vorA vorB vorC ehbA porF porE porB porA porD porC ehbO ehbM ehbL ehbK ehbJ ehbG ehbF ehbE | acetyl-CoA decarbonylase/synthase complex subunit epsilon | acetyl-CoA decarbonylase/synthase complex subunit alpha | hypothetical protein | energy conserving hydrogenase B large subunit | 2-oxoisovalerate oxidoreductase subunit alpha | 2-ketoisovalerate ferredoxin reductase | 2-oxoisovalerate oxidoreductase subunit gamma | acetyl-CoA synthetase, AMP-forming-related | putative monovalent cation/H+ antiporter subunit E | hypothetical protein, pyruvate oxidoreductase-associated | pyruvate ferredoxin oxidoreductase subunit beta | pyruvate oxidoreductase (synthase) subunit alpha | pyruvate oxidoreductase (synthase) subunit delta | pyruvate ferredoxin oxidoreductase subunit gamma | energy conserving hydrogenase B integral membrane subunit | energy conserving hydrogenase B small subunit | ferredoxin | polyferredoxin | putative monovalent cation/H+ antiporter subunit B | hydrogenase subunit F | putative monovalent cation/H+ antiporter subunit C |
| 11 | 23 | 38 | -18.176 | 0.257 | 
Residual = 0.257 |  | 
cTCaCC | 
gtCCCA |  | MMP0044 MMP0093 MMP0094 MMP0150 MMP0151 MMP0159 MMP0258 MMP0259 MMP0572 MMP0574 MMP0575 MMP0576 MMP0577 MMP0578 MMP0625 MMP0971 MMP1472 MMP1473 MMP1509 MMP1584 MMP1705 MMP1708 MMP1709 | rpl40e rpl39e rpl12p rplP0 slyD gatC dapA rps17E aroQ purB and some other nucleotide rps27e rpl44e | hypothetical protein | 50S ribosomal protein L21e | 50S ribosomal protein L40e | 50S ribosomal protein L39e | 50S ribosomal protein L12P | acidic ribosomal protein P0 | Peptidylprolyl isomerase, FKBP-type | aspartyl/glutamyl-tRNA amidotransferase subunit C | dihydrodipicolinate synthase | 30S ribosomal protein S17e | chorismate mutase | 50S ribosomal protein L14e | adenylosuccinate lyase | SAM (and some other nucleotide) binding motif:Spermine synthase | 30S ribosomal protein S27e | 50S ribosomal protein L44e |
| 12 | 25 | 35 | -15.720 | 0.370 | 
Residual = 0.370 |  | 
cGgCATTTTAtaAatCTAtaTgA | 
cgCTaGATtTTgATTGaTGCc |  | MMP0002 MMP0007 MMP0078 MMP0079 MMP0214 MMP0289 MMP0427 MMP0602 MMP0605 MMP0787 MMP0808 MMP0809 MMP0812 MMP0902 MMP1026 MMP1049 MMP1051 MMP1052 MMP1197 MMP1198 MMP1217 MMP1218 MMP1259 MMP1576 MMP1603 | hypD rfc pyrF argS surE P | L-seryl-tRNA selenium transferase related protein | geranylgeranylglyceryl phosphate synthase-like protein | hypothetical protein | orotate phosphoribosyltransferase | nucleotide triphosphatase | Hydrogenase expression/formation protein | replication factor C small subunit | Orotidine-5'-phosphate decarboxylase | Transcriptional regulator, MarR Family Member | Phosphoribosylaminoimidazole carboxylase related protein | arginyl-tRNA synthetase | related to ehbB of Methanothermobacter thermautotrophicus | Survival protein SurE | transport permease protein | nitrate/sulfonate/bicarbonate ABC transporter ATPase subunit | NAD(P)H: rubredoxin oxidoreductase (NPOR) | ferredoxin |
| 13 | 25 | 38 | -11.698 | 0.415 | 
Residual = 0.415 |  | 
tCgCgGGngCT | 
GGagCTtGGGG |  | MMP0022 MMP0023 MMP0052 MMP0154 MMP0226 MMP0336 MMP0337 MMP0420 MMP0421 MMP0422 MMP0449 MMP0633 MMP0686 MMP0687 MMP0709 MMP1016 MMP1058 MMP1358 MMP1397 MMP1533 MMP1534 MMP1606 MMP1613 MMP1635 MMP1637 | hjc tpiA smc1 ssh10b_1 | hypothetical protein | Archaeal Holliday junction resolvase | CBS domain Related protein | conserved archael hypothetical protein | ferredoxin | Rubrerythrin | fructose-bisphosphate aldolase | triosephosphate isomerase | structural maintenance of chromosome protein | Flavoprotein:DNA/pantothenate metabolism flavoprotein | chromatin protein | Thioredoxin:Glutaredoxin:Thioredoxins/glutaredox i n |
| 14 | 33 | 35 | -11.439 | 0.347 | 
Residual = 0.347 |  | 
TGGtGGt | 
GGtGGgAC |  | MMP0019 MMP0021 MMP0056 MMP0099 MMP0124 MMP0125 MMP0126 MMP0152 MMP0222 MMP0428 MMP0895 MMP0905 MMP0907 MMP1024 MMP1048 MMP1080 MMP1089 MMP1103 MMP1117 MMP1143 MMP1175 MMP1262 MMP1287 MMP1348 MMP1350 MMP1373 MMP1438 MMP1491 MMP1492 MMP1499 MMP1521 MMP1587 MMP1648 | cofH flpA bioB purP trzA pyrE | hypothetical protein | FO synthase subunit 2 | General substrate transporter | conserved archaeal fibrillarin homolog | biotin synthase | Cation transporter | vanadium nitrogenase-associated related protein N | TPR repeat | predicted archaeal transcriptional regulator | MCM family related protein | Glycosyl transferase, group 1 | Polysaccharide biosynthesis protein | 5-aminoimidazole-4-carboxamide-1-beta-D- ribofuranosyl 5'-monophosphate--formate ligase | Chlorohydrolase | Orotate phosphoribosyltransferase |
| 15 | 27 | 40 | -16.604 | 0.357 | 
Residual = 0.357 |  | 
gggTGAaAAtaTCgTAAtTT | 
cTGCgGTG |  | MMP0218 MMP0227 MMP0252 MMP0328 MMP0349 MMP0362 MMP0363 MMP0366 MMP0367 MMP0374 MMP0376 MMP0378 MMP0380 MMP0390 MMP0394 MMP0395 MMP0401 MMP0402 MMP0409 MMP0411 MMP1070 MMP1166 MMP1167 MMP1168 MMP1169 MMP1204 MMP1554 | nrdD Component A dnaB hemD metE comD | hypothetical protein | Anaerobic Ribonucleoside-triphosphate reductase | 2-hydroxyglutaryl-CoA dehydratase (Component A) related protein | methanol dehydrogenase regulatory protein related protein | Atrazine chlorohydrolase related protein | DNA polymerase family B | Uroporphyrinogen III synthase | methionine synthase | Sulfopyruvate decarboxylase subunit alpha | related to iron-sulfur flavoprotein of Methanosarcina thermophila | flavoprotein related protein | ABC transporter ATP-binding protein | Metallopeptidase family M24:Xaa-Pro dipeptidase/Xaa-Pro aminopeptidase |
| 16 | 16 | 39 | -17.015 | 0.263 | 
Residual = 0.263 |  | 
AcGGTG | 
GGTTgCAGAAtCCC |  | MMP0081 MMP0082 MMP0083 MMP0162 MMP0163 MMP0597 MMP0639 MMP0640 MMP0641 MMP1148 MMP1306 MMP1308 MMP1426 MMP1474 MMP1616 MMP1640 | gltB arsA flpA rps28e rpl7ae Sm protein tal dcd ileS aspC | glutamate synthase; large subunit; archaeal subunit 2 | glutamate synthase; large subunit; archaeal subunit 3 | hypothetical protein | Putative arsenical pump-driving ATPase | fibrillarin | LSU ribosomal protein L23E | 30S ribosomal protein S28e | 50S ribosomal protein L7Ae | Small nuclear ribonucleoprotein (Sm protein) | putative translaldolase | Bifunctional dCTP deaminase/dUTP diphosphatase | isoleucyl-tRNA synthetase | aspartyl-tRNA synthetase | S-adenosylmethionine synthetase |
| 17 | 25 | 39 | -30.312 | 0.363 | 
Residual = 0.363 |  | 
AttTaTAAtGATTAATcaTGAta | 
ATATnGcTgAATaaaAtAGg |  | MMP0142 MMP0144 MMP0146 MMP0147 MMP0148 MMP0348 MMP0977 MMP0978 MMP0979 MMP0980 MMP0981 MMP0982 MMP0983 MMP0984 MMP0985 MMP1074 MMP1271 MMP1274 MMP1468 MMP1502 MMP1503 MMP1504 MMP1505 MMP1506 MMP1507 | hpcE acsA CooC cdh cdhD cdhB cdhA ehbD vorA porF porE porB porA porD porC | Thiamine pyrophosphate dependent enzyme related to acetolactate synthase | 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase. | hypothetical protein | nitrogenase reductase-like protein | acetyl-CoA synthetase, AMP-forming | CO dehydrogenase maturation factor | acetyl-CoA decarbonylase/synthase complex subunit gamma | acetyl-CoA decarbonylase/synthase complex subunit delta | acetyl-CoA decarbonylase/synthase complex subunit beta | acetyl-CoA decarbonylase/synthase complex subunit epsilon | acetyl-CoA decarbonylase/synthase complex subunit alpha | 2-oxoisovalerate oxidoreductase subunit alpha | acetyl-CoA synthetase, AMP-forming-related | hypothetical protein, pyruvate oxidoreductase-associated | pyruvate ferredoxin oxidoreductase subunit beta | pyruvate oxidoreductase (synthase) subunit alpha | pyruvate oxidoreductase (synthase) subunit delta | pyruvate ferredoxin oxidoreductase subunit gamma |
| 18 | 12 | 38 | -28.047 | 0.131 | 
Residual = 0.131 |  | 
ATgGaAaaggCCCtA | 
gCCCCA |  | MMP0158 MMP0159 MMP0259 MMP0260 MMP0298 MMP0576 MMP0577 MMP0578 MMP0625 MMP0626 MMP0627 MMP1147 | rpl39e rplP0 rpl1P rpl15 dapA rps17E aroQ cmk rpl34e rpl37e | hypothetical protein | 50S ribosomal protein L39e | acidic ribosomal protein P0 | 50S ribosomal protein L1P | 50S ribosomal protein L15e | dihydrodipicolinate synthase | 30S ribosomal protein S17e | chorismate mutase | 50S ribosomal protein L14e | cytidylate kinase | 50S ribosomal protein L34e | 50S ribosomal protein L37e |
| 19 | 32 | 38 | -16.177 | 0.399 | 
Residual = 0.399 |  | 
TATATAtantTTtttAtTTgantT | 
GCCGGA |  | Antisense_27 MMP0041 MMP0042 MMP0278 MMP0344 MMP0405 MMP0407 MMP0632 MMP0736 MMP0762 MMP1067 MMP1223 MMP1244 MMP1245 MMP1246 MMP1247 MMP1248 MMP1249 MMP1257 MMP1258 MMP1475 MMP1511 MMP1555 MMP1556 MMP1557 MMP1558 MMP1559 MMP1586 MMP1609 MMP1610 MMP1637 MMP1712 | tfb gch3 P-loop fwdH fwdF fwdG fwdD fwdA fwdC hemB mcrB mcrD mcrC mcrG mcrA ftr | transcription initiation factor IIB | H/ACA RNA-protein complex component Gar1 | hypothetical protein | GTP cyclohydrolase III | ATP/GTP-binding site motif A (P-loop) | TPR repeat | succinate dehydrogenase/fumarate reductase iron-sulfur subunit | tungsten containing formylmethanofuran dehydrogenase, subunit H | tungsten containing formylmethanofuran dehydrogenase, subunit F | tungsten containing formylmethanofuran dehydrogenase, subunit G | tungsten containing formylmethanofuran dehydrogenase, subunit D | tungsten containing formylmethanofuran dehydrogenase, subunit A | tungsten containing formylmethanofuran dehydrogenase, subunit C | delta-aminolevulinic acid dehydratase | Sodium:alanine symporter | Methyl-coenzyme M reductase I, beta subunit | Methyl-coenzyme M reductase I, protein D | methyl coenzyme M reductase I, protein C | Methyl-coenzyme M reductase I, gamma subunit | Methyl-coenzyme M reductase I, alpha subunit | tetrahydromethanopterin formyltransferase | Transcriptional regulator, LysR Family Member |
| 20 | 21 | 38 | -16.533 | 0.265 | 
Residual = 0.265 |  | 
GGtGATTT | 
CCCAAGTc |  | MMP0044 MMP0045 MMP0046 MMP0093 MMP0596 MMP0901 MMP1131 MMP1208 MMP1318 MMP1443 MMP1444 MMP1445 MMP1473 MMP1474 MMP1509 MMP1705 MMP1706 MMP1707 MMP1708 MMP1709 MMP1710 | idsA NOP5/NOP56 P-loop aIF2_gamma lysS guaA ileS aIF2_alpha rps27e rpl44e | hypothetical protein | bifunctional short chain isoprenyl diphosphate synthase | 50S ribosomal protein L21e | RNA 2'-O-methyl modification protein (NOP5/NOP56) | ATP/GTP-binding site motif A (P-loop):Small GTP-binding protein domain | peptide chain release factor 1 | translation initiation factor IF-2 subunit gamma | Lysyl-tRNA synthetase | GTP1/OBG family:ATP/GTP-binding site motif A (P-loop):TGS domain:Small GTP-binding protein domain | methionine aminopeptidase | GMP synthase subunit A | isoleucyl-tRNA synthetase | H/ACA RNA-protein complex component Nop10p | translation initiation factor IF-2 subunit alpha | 30S ribosomal protein S27e | 50S ribosomal protein L44e |
| 21 | 33 | 38 | -10.181 | 0.451 | 
Residual = 0.451 |  | 
GGCGaGgc | 
CGAtTCCccCC |  | MMP0228 MMP0270 MMP0271 MMP0272 MMP0273 MMP0618 MMP0619 MMP0620 MMP0698 MMP0904 MMP0954 MMP1021 MMP1022 MMP1023 MMP1026 MMP1186 MMP1200 MMP1259 MMP1317 MMP1318 MMP1358 MMP1512 MMP1513 MMP1527 MMP1583 MMP1584 MMP1611 MMP1657 MMP1681 MMP1682 MMP1704 MMP1706 MMP1707 | trm1 comA atwA selD argS lon lysA P lysS alr ald and some other nucleotide recJ aIF2_alpha | N(2),N(2)-dimethylguanosine tRNA methyltransferase | hypothetical protein | ATP binding putative nickel incorporation protein | ABC transporter ATPase subunit | (2R)-phospho-3-sulfolactate synthase | Putative DNA binding protein | methyl coenzyme M reductase, component A2 | selenophosphate synthetase | Transcriptional regulator, TetR Family Member | arginyl-tRNA synthetase | Eukaryotic thiol (cysteine) protease, active site:ATP/GTP-binding site motif A (P-loop):Sigma-54 factor interaction domain:Pu... | Diaminopimelate decarboxylase | NAD(P)H: rubredoxin oxidoreductase (NPOR) | Lysyl-tRNA synthetase | ferredoxin | Alanine racemase | alanine dehydrogenase | aspartate aminotransferase | S-adenosylmethionine decarboxylase related | SAM (and some other nucleotide) binding motif:Spermine synthase | single stranded DNA-specific exonuclease | H/ACA RNA-protein complex component Nop10p | translation initiation factor IF-2 subunit alpha |
| 22 | 33 | 37 | -14.804 | 0.401 | 
Residual = 0.401 |  | 
AAcnCtTGTtATGaCtGAAa | 
ATAAGGttTttnAAaTAAtAA |  | Antisense_2 Antisense_5 MMP0008 MMP0085 MMP0147 MMP0281 MMP0304 MMP0453 MMP0499 MMP0547 MMP0570 MMP0587 MMP0717 MMP0760 MMP0761 MMP0792 MMP0793 MMP0795 MMP0843 MMP0871 MMP0991 MMP1009 MMP1059 MMP1228 MMP1236 MMP1398 MMP1447 MMP1452 MMP1453 MMP1580 MMP1597 MMP1636 MMP1686 | Antisense_1 DP1 napA pyrC dapE ehaE ehaF cbf5 | DNA polymerase II small subunit | hypothetical protein | nitrogenase reductase-like protein | N-glycosylase/DNA lyase | Neutral zinc metallopeptidase, zinc-binding region:CBS domain | RecJ related protein | Na+/H+ exchanger | membrane protein | Dihydroorotase | succinyl-diaminopimelate desuccinylase | Cro repressor family Helix-turn-helix motif containing protein | Dihydropteroate synthase, DHPS:Dihydropteroate synthase-related protein synthase-related protein | General substrate transporter | H/ACA RNA-protein complex component Cbf5p |
| 23 | 21 | 37 | -17.172 | 0.317 | 
Residual = 0.317 |  | 
ttgGGGGa | 
GGCCATGccgTtaGTtTgGGG |  | MMP0035 MMP0069 MMP0113 MMP0115 MMP0321 MMP0322 MMP0476 MMP0477 MMP0496 MMP0528 MMP0563 MMP0742 MMP0799 MMP0997 MMP1019 MMP1224 MMP1329 MMP1553 Unanno_39 Unanno_52 Unanno_7 | rfcB type 1 rdxA Unanno_1 | hypothetical protein | methyltransferase | replication factor C large subunit | Glutamate synthase subunit-related | Transcriptional regulator, TetR Family Member | Blue (type 1) copper domain | ABC-type amino acid transport/signal transduction systems periplasmic component-related | ferredoxin | Nitroreductase family |
| 24 | 27 | 37 | -11.261 | 0.427 | 
Residual = 0.427 |  | 
tACCaCCa | 
GCGAGGG |  | MMP0076 MMP0134 MMP0319 MMP0340 MMP0419 MMP0637 MMP0655 MMP0679 MMP0702 MMP0713 MMP0714 MMP0715 MMP0814 MMP0815 MMP0880 MMP0953 MMP1017 MMP1270 MMP1363 MMP1537 MMP1538 MMP1540 MMP1541 MMP1590 MMP1659 Unanno_2 Unanno_4 | cbiL pycB iorA2 iorB2 aksF cbiH lysC rpoA1 pyrB Unanno_1 | hypothetical protein | precorrin-2 C-20 methyltransferase | pyruvate carboxylase subunit B | Sodium:neurotransmitter symporter | Transcriptional regulator, ArsR family member | Na+/H+ Antiporter related protein | indolepyruvate oxidoreductase subunit alpha 2 | indolepyruvate oxidoreductase subunit B | coenzyme F390 synthetase II | 2-oxosuberate synthase, last step | precorrin-3B C17-methyltransferase | aspartate kinase | bifunctional hexulose-6-phosphate synthase/ribonuclease regulator | DNA-directed RNA polymerase subunit alpha | Cytochrome c heme-binding site | predicted transporter component | aspartate carbamoyltransferase catalytic subunit |
| 25 | 20 | 39 | -17.284 | 0.310 | 
Residual = 0.310 |  | 
caaGGAgcactCGcTGcAAc | 
TtAaTCTGGtG |  | MMP0026 MMP0133 MMP0137 MMP0243 MMP0284 MMP0315 MMP0316 MMP0412 MMP0588 MMP0610 MMP0878 MMP0921 MMP0953 MMP1011 MMP1014 MMP1048 MMP1195 MMP1356 MMP1361 MMP1425 | DP2 guaB dys infB iorB1 iorA1 dph5 tgtA cbiH gltX yneG rpoB2 | DNA polymerase II large subunit | IMP dehydrogenase | putative deoxyhypusine synthase | hypothetical protein | translation initiation factor IF-2 | indolepyruvate oxidoreductase subunit B | indolepyruvate oxidoreductase subunit alpha 1 | diphthine synthase | PUA domain:Queuine/other tRNA-ribosyltransferase:Uncharacterized domain 2:Archaeosine tRNA-ribosyltransferase | Ribonuclease P-related protein | precorrin-3B C17-methyltransferase | glutamyl-tRNA synthetase | putative cytoplasmic protein | DNA-directed RNA polymerase subunit beta'' | tRNA 2'-O-methylase |
| 26 | 14 | 40 | -21.192 | 0.184 | 
Residual = 0.184 |  | 
TCGaGGGG | 
GAgaTTTtcGG |  | MMP0198 MMP0201 MMP0208 MMP0475 MMP0494 MMP0497 MMP0740 MMP0771 MMP0805 MMP0834 MMP1037 MMP1184 MMP1281 MMP1571 | III moeA mtbA | ABC-type iron(III) transport system, ATP binding protein | Molybdenum cofactor biosynthesis protein | hypothetical protein | distinct helicase family member with a unique C-terminal domain including a metal-binding cysteine cluster | possible purine NTPase | Uroporphyrinogen decarboxylase (URO-D) | N-acetyltransferase related protein | GCN5-related N-acetyltransferase |
| 27 | 27 | 39 | -13.535 | 0.339 | 
Residual = 0.339 |  | 
GGTGat | 
TCGAGcGCntC |  | MMP0003 MMP0006 MMP0073 MMP0103 MMP0135 MMP0136 MMP0160 MMP0261 MMP0553 MMP0654 MMP0879 MMP1018 MMP1101 MMP1139 MMP1149 MMP1196 MMP1242 MMP1310 MMP1311 MMP1497 MMP1498 MMP1510 MMP1588 MMP1592 MMP1593 MMP1701 MMP1702 | korA argG thrC leuD ftsA-2 argF ilvC serS cimA subgroup II thiE leuC nadA purO gatA serA trpS hom | 2-oxoglutarate ferredoxin oxidoreductase subunit alpha | 3-dehydroquinate synthase | argininosuccinate synthase | pyridoxine biosynthesis protein | threonine synthase | 3-isopropylmalate dehydratase small subunit | coenzyme F390 synthetase | DNA directed RNA polymerase; subunit L | Ornithine carbamoyltransferase | ketol-acid reductoisomerase | seryl-tRNA synthetase | (R)-citramalate synthase | Aminotransferase (subgroup II) similar to Acetylornithine aminotransferase | thiamine-phosphate pyrophosphorylase | 3-isopropylmalate dehydratase | hypothetical protein | quinolinate synthetase | IMP cyclohydrolase | ferredoxin | aspartyl/glutamyl-tRNA amidotransferase subunit A | D-3-phosphoglycerate dehydrogenase | tryptophanyl-tRNA synthetase | Amino acid-binding ACT | homoserine dehydrogenase |
| 28 | 29 | 37 | -14.286 | 0.352 | 
Residual = 0.352 |  | 
AAAtnGGTGA | 
CGGGaGTTcG |  | Antisense_8 MMP0072 MMP0165 MMP0166 MMP0167 MMP0168 MMP0256 MMP0257 MMP0265 MMP0313 MMP0342 MMP0499 MMP0511 MMP0536 MMP0608 MMP0630 MMP0631 MMP0684 MMP0812 MMP0843 MMP1051 MMP1066 MMP1171 MMP1265 MMP1303 MMP1467 MMP1573 MMP1657 Unanno_59 | Antisense_1 drug/sodium antiporters hisH tbp fmdB Component A feoB hsp20 surE pssA Gln ehaT bioD | hypothetical protein | ABC transporter, family 2 | MatE family member (drug/sodium antiporters) | ABC transporter ATP binding protein family member | Transcriptional regulator PadR-like family | imidazole glycerol phosphate synthase subunit HisH | transcription factor | hypothetical protein protein: possibly conserved | molybdenum containing formylmethanofuran dehydrogenase, subunit B | 2-hydroxyglutaryl-CoA dehydratase (Component A) related protein | ferrous iron transporter (GTP-binding) | putatuve iron dependent repressor | Heat shock protein Hsp20 | Survival protein SurE | putative molybdenum cofactor biosynthesis protein C | archaetidylserine synthase | glutamyl-tRNA(Gln) amidotransferase subunit E | Sensory transduction histidine kinase | Dethiobiotin synthetase |
| 29 | 20 | 38 | -13.244 | 0.340 | 
Residual = 0.340 |  | 
GTnctcaCCatCcCg | 
GCGgTG |  | MMP0101 MMP0221 MMP0286 MMP0567 MMP0603 MMP0657 MMP0839 MMP0840 MMP1030 MMP1031 MMP1407 MMP1408 MMP1409 MMP1422 MMP1432 MMP1434 MMP1523 MMP1524 MMP1537 MMP1538 | putP aIF-1A adkA rps17p rpl14p secY purA nusG secD secF | hypothetical protein | Sodium/proline symporter | translation initiation factor IF-1A | Transcriptional regulator, TetR Family Member | adenylate kinase | ribonuclease P protein component 1 | 30S ribosomal protein S17P | 50S ribosomal protein L14P | preprotein translocase subunit SecY | adenylosuccinate synthetase | transcription antitermination protein NusG | preprotein translocase subunit SecD | preprotein translocase subunit SecF | Cytochrome c heme-binding site | predicted transporter component |
| 30 | 26 | 40 | -15.505 | 0.302 | 
Residual = 0.302 |  | 
gGGGGAtA | 
GAGTTCACTTTTTTTAGG |  | MMP0209 MMP0303 MMP0332 MMP0416 MMP0445 MMP0532 MMP0601 MMP0724 MMP0726 MMP0734 MMP0754 MMP0755 MMP0764 MMP0765 MMP0770 MMP0798 MMP0827 MMP0846 MMP0915 MMP0916 MMP0944 MMP0972 MMP1225 MMP1632 Unanno_37 Unanno_58 | P-loop cobY/cofC yqiX | hypothetical protein | rubredoxin | ATP/GTP-binding site motif A (P-loop) | probable ABC transporter | nucleoside triphosphate: 5'-deoxyadenosylcobinamide phosphate nucleotidyltransferase | amino acid ABC-type transporter related protein | Solute-binding protein/glutamate receptor:Bacterial extracellular solute-binding protein, family 3 |
| 31 | 31 | 39 | -13.806 | 0.328 | 
Residual = 0.328 |  | 
GGgGGnGt | 
TGAcTGAgTAGTCAaTCTTA |  | Antisense_12 Antisense_28 MMP0194 MMP0195 MMP0198 MMP0208 MMP0375 MMP0435 MMP0436 MMP0437 MMP0473 MMP0474 MMP0475 MMP0484 MMP0495 MMP0501 MMP0519 MMP0673 MMP0740 MMP0778 MMP0779 MMP0782 MMP0801 MMP0802 MMP0826 MMP0998 MMP1088 MMP1110 MMP1172 MMP1347 MMP1596 | III rimK HMmB | hypothetical protein | ABC-type iron(III) transport system, ATP binding protein | putative SSU ribosomal protein S6 modification protein | possible sodium/proton antiporter | TPR repeat | possible purine NTPase | Iron-containing alcohol dehydrogenase | Glycosyl transferase, group 1 | archaeal histone B |
| 32 | 6 | 39 | -81.093 | 0.029 | 
Residual = 0.029 |  | 
CCGagTatTatgGaCcGAGGaCc | 
AGGTcgtgcaTAAGCCTcCg |  | RNA_38 RNA_39 RNA_40 RNA_41 RNA_42 RNA_44 | rrnA23S rrnA16S rrnB23S rrnB16S rrnC23S rrnC16S | 23S ribosomal RNA | 16S ribosomal RNA |
| 33 | 17 | 38 | -26.152 | 0.207 | 
Residual = 0.207 |  | 
TgTaaATTtGGgGGTGagA | 
CggAATCTAGC |  | MMP0304 MMP0305 MMP0306 MMP0307 MMP0311 MMP0599 MMP0600 MMP0691 MMP0693 MMP0903 MMP1059 MMP1060 MMP1234 MMP1387 MMP1683 Unanno_13 Unanno_39 | cbiJ cysS | N-glycosylase/DNA lyase | 2-oxoacid ferredoxin oxidoreductase subunit beta | oxidoreductase family member subunit alpha | hypothetical protein | Precorrin-6x reductase CbiJ/CobK | Aminoacyl-tRNA synthetase, class II | cysteinyl-tRNA synthetase |
| 34 | 19 | 39 | -35.460 | 0.160 | 
Residual = 0.160 |  | 
ccGTGGttnAGCcTG | 
GGTTCaAATcCCGGctgntccag |  | RNA_10 RNA_11 RNA_12 RNA_15 RNA_18 RNA_25 RNA_29 RNA_30 RNA_32 RNA_35 RNA_36 RNA_38 RNA_39 RNA_4 RNA_40 RNA_41 RNA_42 RNA_44 Unanno_41 | tRNA-Arg1 tRNA-Glu1 tRNA-Val1 tRNA-Arg3 tRNA-Ile1 tRNA-His1 tRNA-Gly1 tRNA-Gly2 tRNA-Ser3 tRNA-Thr2 tRNA-Ala2 rrnA23S rrnA16S rrnB23S rrnB16S rrnC23S rrnC16S | tRNA-Arg | tRNA-Glu | tRNA-Val | tRNA-Ile | tRNA-His | tRNA-Gly | tRNA-Ser | tRNA-Thr | tRNA-Ala | 23S ribosomal RNA | 16S ribosomal RNA |
| 35 | 30 | 39 | -14.536 | 0.429 | 
Residual = 0.429 |  | 
ACtgcTaAATCGtTTTTaAAAT | 
ACTAagtgaaTAAATatgnCTTT |  | MMP0076 MMP0077 MMP0219 MMP0383 MMP0590 MMP0591 MMP0592 MMP0593 MMP0718 MMP0719 MMP1073 MMP1190 MMP1191 MMP1373 MMP1493 MMP1518 MMP1519 MMP1520 MMP1560 MMP1561 MMP1562 MMP1563 MMP1564 MMP1565 MMP1566 MMP1567 MMP1643 MMP1644 MMP1717 MMP1718 | ppaC slp ehbC mch purP P-loop mtrE mtrD mtrC mtrB mtrA or900 mtrG mtrH | hypothetical protein | putative manganese-dependent inorganic pyrophosphatase | S-layer protein | Glycosyl transferase, family 2 | walker type ATPase | predicted transcriptional regluator | putative monovalent cation/H+ antiporter subunit G | Peptidylprolyl isomerase, FKBP-type | N(5),N(10)-methenyltetrahydromethanopterin cyclohydrolase | 5-aminoimidazole-4-carboxamide-1-beta-D- ribofuranosyl 5'-monophosphate--formate ligase | sulfate/molybdate ABC-transporter homolog, ATPase subunit | anion transport system permease protein | ATP/GTP-binding site motif A (P-loop):HypB/UreG, nucleotide-binding:Hydrogenase accessory protein HypB | tetrahydromethanopterin S-methyltransferase subunit E | tetrahydromethanopterin S-methyltransferase subunit D | tetrahydromethanopterin S-methyltransferase subunit C | tetrahydromethanopterin S-methyltransferase subunit B | tetrahydromethanopterin S-methyltransferase subunit A | tetrahydromethanopterin S-methyltransferase subunit G | tetrahydromethanopterin S-methyltransferase subunit H | possible methyltransferase related protein |
| 36 | 13 | 41 | -23.441 | 0.178 | 
Residual = 0.178 |  | 
TGAGGgG | 
CnTgCAaAtCccGt |  | MMP0107 MMP0767 MMP0769 MMP0790 MMP0796 MMP0823 MMP0834 MMP0974 MMP1078 MMP1526 MMP1535 MMP1536 MMP1655 | vhcA mtbA rncS | hypothetical protein | probable sugar efflux transporter | coenzyme F420-non-reducing hydrogenase subunit alpha | Uroporphyrinogen decarboxylase (URO-D) | Ribonuclease III family:Double-stranded RNA binding (DsRBD) domain |
| 37 | 18 | 41 | -22.397 | 0.210 | 
Residual = 0.210 |  | 
AAgAaAaGtgGaAaTgagTGgaG | 
GCgAGgTTGC |  | Antisense_11 Antisense_14 Antisense_15 Antisense_17 Antisense_19 Antisense_20 Antisense_21 Antisense_25 Antisense_26 Antisense_28 Antisense_7 MMP0129 MMP0672 MMP0821 MMP1478 MMP1528 Unanno_30 Unanno_46 | Antisense_1 vhcD cbiA pheA | hypothetical protein | Binding-protein-dependent transport systems inner membrane component:Ketopantoate reductase ApbA/PanE | coenzyme F420-non-reducing hydrogenase subunit delta | Cobyrinic acid a,c-diamide synthase:Cobyrinic acid a,c-diamide synthase CbiA | prephenate dehydratase |
| 38 | 29 | 37 | -8.981 | 0.471 | 
Residual = 0.471 |  | 
CCCTCcCc | 
ACCACC |  | MMP0221 MMP0233 MMP0243 MMP0351 MMP0352 MMP0386 MMP0419 MMP0655 MMP0679 MMP0689 MMP0701 MMP0702 MMP0736 MMP0737 MMP0839 MMP0840 MMP0910 MMP0911 MMP1094 MMP1103 MMP1130 MMP1270 MMP1471 MMP1541 MMP1643 MMP1714 MMP1715 MMP1716 Unanno_45 | putP aspB-like1 HMmA ppsA hmdII | Sodium/proline symporter | hypothetical protein | DegT/DnrJ/EryC1/StrS aminotransferase | Putative oxidoreductase | archaeal histone A | Sodium:neurotransmitter symporter | Na+/H+ Antiporter related protein | Xanthine/uracil permease family | L-aspartate dehydrogenase | Transcriptional regulator, TetR Family Member | related to iron-sulfur flavoprotein of Methanosarcina thermophila | phosphoenolpyruvate synthase | bifunctional hexulose-6-phosphate synthase/ribonuclease regulator | putative GTPase | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase-related protein |
| 39 | 28 | 39 | -11.262 | 0.438 | 
Residual = 0.438 |  | 
GGtGAAantnnngaaGaAgc | 
GgCCTC |  | MMP0087 MMP0088 MMP0096 MMP0164 MMP0242 MMP0388 MMP0389 MMP0629 MMP0644 MMP0645 MMP0646 MMP0650 MMP0651 MMP0874 MMP0875 MMP0884 MMP0888 MMP0889 MMP0965 MMP1176 MMP1177 MMP1178 MMP1181 MMP1182 MMP1183 MMP1437 MMP1700 Unanno_9 | hmgA hemA subgroup I cbiX(s) mdh ilvB ilvH and some other nucleotide slpB III top6A Unanno_1 | Hydroxymethylglutaryl-coenzyme A reductase:3-hydroxy-3-methylglutaryl Coenzyme A reductase | glutamyl-tRNA reductase | Aminotransferase (subgroup I) | sirohydrochlorin cobaltochelatase | hypothetical protein | geranylgeranyl bacterial chlorophyll reductase related | ferredoxin | Cation efflux protein | malate dehydrogenase | acetolactate synthase catalytic subunit | acetolactate synthase 3 regulatory subunit | SAM (and some other nucleotide) binding motif | S layer protein | cobalt transport protein CbiN | cobalt transport protein CbiM | formylmethanofuran dehydrogenase subunit E related protein | putative iron transport system substrate-binding protein, N-term half | putative iron transport system substrate-binding protein, C-term half | iron transport Periplasmic binding protein | iron transport system binding protein | Iron(III) dicitrate transport system permease protein | iron ABC transporter ATPase subunit | DNA topoisomerase VI subunit A | Na+/solute symporter |
| 40 | 23 | 38 | -14.838 | 0.302 | 
Residual = 0.302 |  | 
AaTTCACCan | 
CCgcaGAGG |  | MMP0098 MMP0230 MMP0318 MMP0326 MMP0393 MMP0408 MMP0541 MMP0583 MMP0708 MMP0872 MMP0887 MMP0947 MMP1032 MMP1075 MMP1076 MMP1077 MMP1116 MMP1129 MMP1205 MMP1260 MMP1266 MMP1701 MMP1702 | ilvD metG serB hemC hisG rpa dut ppiB aroA Gln hom | ferredoxin | hypothetical protein | Dihydroxy-acid dehydratase | methionyl-tRNA synthetase | phosphoesterase-like protein | H+-transporting two-sector ATPase, A subunit | Phosphoserine phosphatase | Porphobilinogen deaminase | ATP phosphoribosyltransferase | replication factor A | dUTP diphosphatase | Bacterial transferase hexapeptide repeat:ADP-glucose pyrophosphorylase | Phosphoglucomutase/phosphomannomutase:Calcium- bin ding EF-hand | endoglucanase | Peptidyl-prolyl cis-trans isomerase, cyclophilin type | 3-phosphoshikimate 1-carboxyvinyltransferase | glutamyl-tRNA(Gln) amidotransferase subunit D | Amino acid-binding ACT | homoserine dehydrogenase |
| 41 | 24 | 37 | -11.065 | 0.483 | 
Residual = 0.483 |  | 
GctgCTGaAAc | 
TAttgtgGAnaaAatAGGG |  | MMP0026 MMP0108 MMP0141 MMP0142 MMP0144 MMP0146 MMP0216 MMP0493 MMP0610 MMP0670 MMP0861 MMP0862 MMP0866 MMP0867 MMP0868 MMP1150 MMP1200 MMP1334 MMP1441 MMP1585 MMP1612 MMP1651 MMP1700 Unanno_28 | DP2 III hpcE cobN tgtA kamA yodP proX proV mtaA lysA P-loop mobB modA | DNA polymerase II large subunit | ABC-type Iron(III)-binding periplasmic protein precursor | hypothetical protein | Thiamine pyrophosphate dependent enzyme related to acetolactate synthase | 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase. | cation transport ATPase | cobaltochelatase | PUA domain:Queuine/other tRNA-ribosyltransferase:Uncharacterized domain 2:Archaeosine tRNA-ribosyltransferase | Lysine 2,3-aminomutase | GCN5-related N-acetyltransferase | putative glycine betaine/L-proline ABC transporter, solute-binding protein | ABC-type proline/glycine betaine transport system, permease component related protein | CBS domain:ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase | Uroporphyrinogen decarboxylase (URO-D) | Diaminopimelate decarboxylase | Solute-binding protein/glutamate receptor:ATP/GTP-binding site motif A (P-loop):GTP-binding protein, HSR1-related:GTP-binding... | ATP/GTP-binding site motif A (P-loop):Molybdopterin-guanine dinucleotide biosynthesis protein | Arginase | periplasmic molybdate-binding protein | Na+/solute symporter |
| 42 | 40 | 40 | -11.073 | 0.382 | 
Residual = 0.382 |  | 
CCCGGCcG | 
gGCTTCACC |  | Antisense_16 MMP0174 MMP0188 MMP0208 MMP0228 MMP0361 MMP0436 MMP0437 MMP0473 MMP0495 MMP0522 MMP0523 MMP0565 MMP0653 MMP0756 MMP0766 MMP0772 MMP0775 MMP0777 MMP0796 MMP0807 MMP0831 MMP0834 MMP0869 MMP0892 MMP1020 MMP1226 MMP1280 MMP1389 MMP1476 MMP1536 MMP1596 MMP1620 MMP1655 MMP1660 MMP1664 MMP1678 RNA_34 Unanno_16 Unanno_26 | trm1 rimK resP mtbA nfo tRNA-Met4 | HD phosphohydrolase family member | hypothetical protein | N(2),N(2)-dimethylguanosine tRNA methyltransferase | putative SSU ribosomal protein S6 modification protein | ABC transporter ATP-binding protein | sodium-dependent transporter | Site-specific recombinase | probable sugar efflux transporter | Carboxymuconolactone decarboxylase Related Protein | methylcobalamin:coenzyme M methyltransferase | Uroporphyrinogen decarboxylase (URO-D) | Cytidine/deoxycytidylate deaminase, zinc-binding region related protein | acetyltransferase related protein | endonuclease IV | tRNA-Met |
| 43 | 29 | 38 | -18.212 | 0.304 | 
Residual = 0.304 |  | 
TtGnagGGGGG | 
ACCCCtTctCAtatActCccG |  | Antisense_10 MMP0102 MMP0172 MMP0294 MMP0304 MMP0305 MMP0306 MMP0614 MMP0634 MMP0710 MMP0711 MMP0718 MMP0719 MMP0762 MMP0763 MMP0783 MMP0784 MMP0964 MMP0996 MMP0997 MMP1257 MMP1291 MMP1292 MMP1293 MMP1294 MMP1295 MMP1604 MMP1703 Unanno_57 | pcm corA type 1 glucoamylase glgA | Protein-L-isoaspartate(D-aspartate) O-methyltransferase | hypothetical protein | Bacterial quinoprotein | N-glycosylase/DNA lyase | 2-oxoacid ferredoxin oxidoreductase subunit beta | oxidoreductase family member subunit alpha | related to iron-sulfur flavoprotein of Methanosarcina thermophila | cation-transporting ATPase | magnesium, nickel and cobalt transport protein | predicted transcriptional regluator | TPR repeat | Blue (type 1) copper domain | Glycoside hydrolase, family 57 | glucan 1,4-alpha-glucosidase (glucoamylase) | Glycosyl transferase, group 1 | glucose-6-phosphate isomerase |
| 44 | 31 | 40 | -12.842 | 0.434 | 
Residual = 0.434 |  | 
TTTGGgGg | 
CCTGAAAaggTgTAAttTCCa |  | MMP0057 MMP0138 MMP0192 MMP0275 MMP0343 MMP0466 MMP0467 MMP0468 MMP0469 MMP0470 MMP0471 MMP0472 MMP0490 MMP0491 MMP0492 MMP0493 MMP0502 MMP0680 MMP0735 MMP0851 MMP1193 MMP1194 MMP1481 MMP1482 MMP1483 MMP1602 Unanno_15 Unanno_22 Unanno_29 Unanno_31 Unanno_48 | cofH fdhA cobN upp cbiM cbiQ | FO synthase subunit 2 | formate dehydrogenase alpha subunit | hypothetical protein | MCM family related protein | Probable integrase/recombinase | MotA/TolQ/ExbB proton channel | cobaltochelatase | uracil phosphoribosyltransferase | N-6 Adenine-specific DNA methylase:N6 adenine-specific DNA methyltransferase, D12 class | Collagen triple helix repeat:Surface protein from Gram-positive cocci, anchor region | cobalt transport protein CbiM | cobalt transport protein CbiN | Cobalt transport protein Q |
| 45 | 23 | 38 | -13.953 | 0.401 | 
Residual = 0.401 |  | 
agTTcATgtATACacCgc | 
GGtATGGTaCcCnc |  | MMP0184 MMP0211 MMP0361 MMP0365 MMP0375 MMP0463 MMP0475 MMP0594 MMP0739 MMP0758 MMP0759 MMP0825 MMP0828 MMP0845 MMP0908 MMP1020 MMP1173 MMP1180 MMP1296 MMP1476 MMP1529 RNA_33 Unanno_38 | hdrA pfkC tRNA-Met3 | hypothetical protein | Asp/Glu racemase:Aspartate racemase | HNH endonuclease:HNH nuclease | heterodisulfide reductase subunit A | CBS domain | ADP-specific phosphofructokinase | tRNA-Met |
| 46 | 31 | 38 | -9.812 | 0.451 | 
Residual = 0.451 |  | 
AtCACC | 
TcAGgcAGGatgGTG |  | MMP0001 MMP0002 MMP0176 MMP0234 MMP0251 MMP0252 MMP0363 MMP0373 MMP0374 MMP0387 MMP0394 MMP0395 MMP0411 MMP0427 MMP0516 MMP0656 MMP0658 MMP0729 MMP0939 MMP1140 MMP1168 MMP1169 MMP1185 MMP1197 MMP1217 MMP1218 MMP1221 MMP1390 MMP1477 Unanno_36 Unanno_7 | psmA hemD comD rfc modD uvrA fdxA and some other nucleotide cbiA Unanno_1 | hypothetical protein | L-seryl-tRNA selenium transferase related protein | CDC48 cell division cycle protein family member | proteasome subunit alpha | methanol dehydrogenase regulatory protein related protein | microsomal signal peptidase 21 KD subunit | Uroporphyrinogen III synthase | Sulfopyruvate decarboxylase subunit alpha | replication factor C small subunit | molybdate transporter subunit | MoaA/nifB/pqqE family | excinuclease ABC subunit A | ferredoxin | ABC transporter ATP-binding protein | Hydrogen uptake protein:Hydrogenase maturation protease HycI | transport permease protein | SAM (and some other nucleotide) binding motif | Cobyrinic acid a,c-diamide synthase |
| 47 | 19 | 37 | -18.068 | 0.270 | 
Residual = 0.270 |  | 
TaAnTTaTccGgaAATTaCc | 
CCCCgCC |  | MMP0291 MMP0320 MMP0415 MMP0582 MMP0681 MMP0713 MMP0714 MMP0938 MMP0970 MMP1024 MMP1117 MMP1128 MMP1143 MMP1287 MMP1288 MMP1313 MMP1348 MMP1350 MMP1648 | archaeal iorA2 iorB2 cobS lig ppiB fen-1 | hydrogenase expression/formation protein related | shikimate kinase (archaeal) | O-sialoglycoprotein endopeptidase/protein kinase | AzlC related protein | Xanthine/uracil permease family | indolepyruvate oxidoreductase subunit alpha 2 | indolepyruvate oxidoreductase subunit B | cobalamin (5'-phosphate) synthase | ATP-dependent DNA ligase | MCM family related protein | hypothetical protein | Peptidyl-prolyl cis-trans isomerase, cyclophilin type | TPR repeat | flap endonuclease-1 |
| 48 | 21 | 38 | -14.315 | 0.312 | 
Residual = 0.312 |  | 
TTgGaGGg | 
CCCgATaAAAA |  | MMP0192 MMP0275 MMP0466 MMP0467 MMP0468 MMP0469 MMP0470 MMP0471 MMP0472 MMP0502 MMP0533 MMP0680 MMP0851 MMP1193 MMP1194 MMP1481 MMP1482 MMP1483 MMP1602 Unanno_29 Unanno_31 | upp cbiM cbiQ | hypothetical protein | MCM family related protein | Probable integrase/recombinase | uracil phosphoribosyltransferase | Collagen triple helix repeat:Surface protein from Gram-positive cocci, anchor region | cobalt transport protein CbiM | cobalt transport protein CbiN | Cobalt transport protein Q |
| 49 | 36 | 38 | -11.106 | 0.489 | 
Residual = 0.489 |  | 
tagATATATtGGTGa | 
cAAGTcTGGTGG |  | Antisense_13 Antisense_24 MMP0020 MMP0036 MMP0063 MMP0084 MMP0239 MMP0268 MMP0277 MMP0279 MMP0302 MMP0307 MMP0562 MMP0643 MMP0725 MMP0727 MMP0742 MMP0902 MMP0918 MMP1218 MMP1235 MMP1282 MMP1283 MMP1290 MMP1343 MMP1345 MMP1346 MMP1372 MMP1430 MMP1431 MMP1551 MMP1603 MMP1606 MMP1607 Unanno_42 Unanno_62 | tfe argB truA mptG uvrB asnB moaE Di-trans-poly-cis-decaprenylcistransferase manB K+ 2pgk ffh | nickel responsive regulator | transcription initiation factor E subunit alpha | acetylglutamate kinase | hypothetical protein | tRNA pseudouridine synthase A | TraB family | beta-ribofuranosylaminobenzene 5'-phosphate synthase | putative integral membrane protein | excinuclease ABC subunit B | Asparagine synthetase (glutamine-hydrolyzing) | Molybdopterin biosynthesis MoaE | GTP-binding protein | undecaprenyl pyrophospahte synthetase related protein (Di-trans-poly-cis-decaprenylcistransferase) | Basic helix-loop-helix dimerization domain bHLH | Phosphoglucomutase/phosphomannomutase | putative TRK system cation (K+) uptake protein | 2-phosphoglycerate kinase | signal recognition particle protein Srp54 | ferredoxin | Flavoprotein:DNA/pantothenate metabolism flavoprotein |
| 50 | 21 | 37 | -15.791 | 0.342 | 
Residual = 0.342 |  | 
TTnggGgGAT | 
CCTtTTtcGcC |  | Antisense_27 MMP0123 MMP0184 MMP0373 MMP0387 MMP0558 MMP0622 MMP0624 MMP0633 MMP0683 MMP0692 MMP0864 MMP0912 MMP0913 MMP0914 MMP1220 MMP1237 MMP1475 MMP1613 MMP1635 MMP1654 | purT draG ftsY napA-2 glgP ssh10b_1 | phosphoribosylglycinamide formyltransferase 2 | hypothetical protein | microsomal signal peptidase 21 KD subunit | ADP-ribosylglycohydrolase (draG) homolog | Rubrerythrin | signal recognition particle receptor SRalpha | Na+/H+ exchanger | tautomerase related protein | glycogen phosphorylase | chromatin protein | Thioredoxin:Glutaredoxin:Thioredoxins/glutaredox i n |
| 51 | 28 | 36 | -10.108 | 0.456 | 
Residual = 0.456 |  | 
CTGCTgCTGAGG | 
GcACCTGTtG |  | MMP0046 MMP0074 MMP0091 MMP0116 MMP0141 MMP0142 MMP0268 MMP0286 MMP0440 MMP0441 MMP0442 MMP0443 MMP0444 MMP0670 MMP0671 MMP0694 MMP0695 MMP0884 MMP0901 MMP1064 MMP1380 MMP1381 MMP1399 MMP1431 MMP1432 MMP1444 MMP1590 MMP1594 | argC truA rpoE2 rps24e ywbE psmB P-loop RNA recognition motif 2pgk purA | hypothetical protein | N-acetyl-gamma-glutamyl-phosphate reductase | Thiamine pyrophosphate dependent enzyme related to acetolactate synthase | tRNA pseudouridine synthase A | DNA-directed RNA polymerase subunit E' | DNA-directed RNA polymerase subunit E | 30S ribosomal protein S24e | 30S ribosomal protein S27ae | Beta-lactamase-like:KH domain | proteasome, subunit beta | ATP/GTP-binding site motif A (P-loop):Small GTP-binding protein domain | RNA-binding region RNP-1 (RNA recognition motif):Adenylate cyclase | chlorohydrolase | Beta-lactamase-like:ATP/GTP-binding site motif A (P-loop) | Aspartate/glutamate/uridylate kinase | 2-phosphoglycerate kinase | adenylosuccinate synthetase | methionine aminopeptidase |
| 52 | 31 | 37 | -13.583 | 0.392 | 
Residual = 0.392 |  | 
AtCgGTaAGtTTnGAgGtAaaacC | 
acACcggAAataTTgTTccaaGC |  | Antisense_6 MMP0013 MMP0025 MMP0202 MMP0203 MMP0218 MMP0262 MMP0355 MMP0376 MMP0377 MMP0378 MMP0409 MMP0410 MMP0446 MMP0488 MMP0489 MMP0498 MMP0561 MMP0617 MMP0655 MMP0811 MMP1093 MMP1117 MMP1120 MMP1253 MMP1312 MMP1313 MMP1314 MMP1648 Unanno_14 Unanno_33 | Antisense_1 argH prsA cmd radB coaD fen-1 | argininosuccinate lyase | hypothetical protein | isoleucyl-tRNA synthetase related | Atrazine chlorohydrolase related protein | ribose-phosphate pyrophosphokinase | Nitrogen fixation-related protein | Low molecular weight phosphotyrosine protein phosphatase | Carboxymuconolactone decarboxylase:Alkylhydroperoxidase AhpD core domain | DNA repair and recombination protein RadB | phosphopantetheine adenylyltransferase | ATP-binding protein, ATPase-like:Histidine kinase, HAMP region:Histidine kinase A, N-terminal:Bacterial sensor protein C-term... | flap endonuclease-1 | Phosphoesterase, RecJ-like:RNA binding S1:OB-fold nucleic acid binding domain Related protein |
| 53 | 29 | 39 | -16.260 | 0.262 | 
Residual = 0.262 |  | 
gCggtAtCCGAgg | 
cATGCCtTGA |  | MMP0200 MMP0437 MMP0462 MMP0513 MMP0515 MMP0766 MMP0767 MMP0769 MMP0773 MMP0774 MMP0776 MMP0782 MMP0790 MMP0796 MMP0800 MMP0802 MMP0803 MMP0805 MMP0823 MMP0837 MMP0838 MMP0896 MMP1339 MMP1526 MMP1536 MMP1620 MMP1649 MMP1650 Unanno_40 | fmdE MoeA modB resP vhcA and some other nucleotide rncS modC | molybdenum containing formylmethanofuran dehydrogenase, subunit E | hypothetical protein | molybdopterin biosynthesis moeA protein | Molybdenum ABC transporter, permease protein | Site-specific recombinase | probable sugar efflux transporter | Iron-containing alcohol dehydrogenase | coenzyme F420-non-reducing hydrogenase subunit alpha | RNase HI related protein | Polysaccharide biosynthesis protein | SAM (and some other nucleotide) binding motif | Ribonuclease III family:Double-stranded RNA binding (DsRBD) domain | ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase:TOBE domain | probable amino acid ABC transporter, periplasmic component |
| 54 | 17 | 40 | -18.405 | 0.246 | 
Residual = 0.246 |  | 
gaAAcCtCCc | 
GGCtTGcAGA |  | MMP0027 MMP0070 MMP0215 MMP0455 MMP0482 MMP0483 MMP0612 MMP0621 MMP0638 MMP0672 MMP0693 MMP0863 MMP0903 MMP1234 MMP1552 MMP1605 MMP1641 | LigT | putative potassium channel protein | tungsten containing formylmethanofruran dehydrogenase subunit C-related protein | hypothetical protein | Probable amino-acid ABC transporter | 2'-5' RNA ligase | Binding-protein-dependent transport systems inner membrane component:Ketopantoate reductase ApbA/PanE | Aminoacyl-tRNA synthetase, class II | CBS domain | Flavoprotein:Phenylacrylic acid decarboxylase, 3-octaprenyl-4-hydroxybenzoate carboxy-lyase | Pyruvate kinase | soluble P-type ATPase |
| 55 | 21 | 39 | -18.832 | 0.311 | 
Residual = 0.311 |  | 
gCgatgGGGtggAaGAgTACCTG | 
AAtTGgTGAa |  | MMP0120 MMP0121 MMP0482 MMP0483 MMP0543 MMP0544 MMP0545 MMP0638 MMP0902 MMP0903 MMP0992 MMP1065 MMP1234 MMP1235 MMP1236 MMP1240 MMP1241 MMP1428 MMP1487 MMP1551 MMP1607 | moaE gapN ffh | hypothetical protein | MoaA/nifB/pqqE family | Molybdenum cofactor biosynthesis protein:MoeA N-terminal region, domain I and II:MoeA C-terminal, domain IV | Molybdopterin biosynthesis MoaE | Sep-tRNA:Cys-tRNA synthetase | Aldehyde dehydrogenase | signal recognition particle protein Srp54 |
| 56 | 8 | 37 | -27.480 | 0.126 | 
Residual = 0.126 |  | 
GGcGCg | 
GGAGGt |  | MMP0259 MMP0260 MMP0626 MMP0627 MMP1544 MMP1545 MMP1546 MMP1547 | rplP0 rpl1P cmk rpl34e rpl4lp rplW rpl2p rps19p | acidic ribosomal protein P0 | 50S ribosomal protein L1P | cytidylate kinase | 50S ribosomal protein L34e | 50S ribosomal protein L4P | 50S ribosomal protein L23 | 50S ribosomal protein L2P | 30S ribosomal protein S19P |
| 57 | 17 | 40 | -18.755 | 0.194 | 
Residual = 0.194 |  | 
GGgCCTG | 
CtgCATGCg |  | MMP0027 MMP0121 MMP0122 MMP0207 MMP0425 MMP0426 MMP0465 MMP0534 MMP0535 MMP0569 MMP0612 MMP0621 MMP0958 MMP0959 MMP1001 MMP1514 MMP1641 | modC LigT trxB tyrA | putative potassium channel protein | hypothetical protein | Molybdenum transport ATP-binding protein modC | Nitroreductase family | 2'-5' RNA ligase | thioredoxin reductase | prephenate dehydrogenase | soluble P-type ATPase |
| 58 | 33 | 38 | -10.108 | 0.489 | 
Residual = 0.489 |  | 
ACcTACAAaAAtAcAntatAT | 
CGTTTCCTCGTGCAC |  | Antisense_3 MMP0050 MMP0051 MMP0059 MMP0096 MMP0097 MMP0180 MMP0181 MMP0209 MMP0210 MMP0256 MMP0257 MMP0369 MMP0480 MMP0487 MMP0524 MMP0613 MMP0712 MMP0722 MMP0734 MMP0757 MMP0788 MMP0922 MMP0923 MMP0932 MMP1134 MMP1135 MMP1136 MMP1229 MMP1439 MMP1493 MMP1550 Unanno_47 | Antisense_1 ribH hisE subgroup I ribC hisH tbp dapB | riboflavin synthase subunit beta | phosphoribosyl-ATP pyrophosphatase | hypothetical protein | Aminotransferase (subgroup I) | Transcriptional regulator protein, Helix-turn-helix motif | riboflavin synthase | imidazole glycerol phosphate synthase subunit HisH | transcription factor | Alpha-acetolactate decarboxylase | similar to amino acid ABC transporter substrate-binding protein | possible phage infection protein | dihydrodipicolinate reductase | probable chemotaxis-related protein | type A flavoprotein | Flavodoxin:Beta-lactamase-like | Rubrerythrin | cofactor-independent phosphoglycerate mutase | NADP oxidoreductase, coenzyme F420-dependent |
| 59 | 16 | 40 | -28.602 | 0.185 | 
Residual = 0.185 |  | 
ACCTACAcAAAcAc | 
GAGCcG |  | MMP0413 MMP0927 MMP0928 MMP0929 MMP0931 MMP0932 MMP0933 MMP1666 MMP1667 MMP1668 MMP1669 MMP1670 MMP1671 MMP1672 MMP1673 MMP1719 | cheA cheD MCP cheY flaB1 flaB2 flaB3 flaC flaD flaE flaF flaG | hypothetical protein | Chemotaxis protein CheA | chemotaxis protein CheD | Methyl-accepting chemotaxis protein (MCP) | probable chemotaxis-related protein | chemotaxis protein CheY | flagellin | flagella accessory protein C | flagella accessory protein D | flagella accessory protein E | flagella accessory protein F | flagella accessory protein G |
| 60 | 18 | 38 | -17.517 | 0.238 | 
Residual = 0.238 |  | 
cGaATTtaCgG | 
CTCGCACC |  | MMP0080 MMP0081 MMP0224 MMP0297 MMP0417 MMP0418 MMP0696 MMP0880 MMP0893 MMP0894 MMP0955 MMP1017 MMP1146 MMP1188 MMP1189 MMP1255 MMP1480 MMP1640 | gltB hemL aIF-2_beta hisA proS aksF pyrG guaA sucD lysC purF pheT | glutamate synthase; large subunit; archaeal subunit 1 | glutamate synthase; large subunit; archaeal subunit 2 | glutamate-1-semialdehyde aminotransferase | translation initiation factor IF-2 subunit beta | 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)me thylideneamino)imidazole-4-carboxamide isomerase | Carbohydrate kinase, PfkB | prolyl-tRNA synthetase | 2-oxosuberate synthase, last step | CTP synthetase | GMP synthase subunit B | succinyl-CoA synthetase subunit alpha | aspartate kinase | Amidophosphoribosyltransferase | hypothetical protein | Ribose 5-phosphate isomerase | phenylalanyl-tRNA synthetase subunit beta | aconitase Family | S-adenosylmethionine synthetase |
| 61 | 24 | 37 | -16.874 | 0.232 | 
Residual = 0.232 |  | 
GggGAGG | 
GccGACAG |  | MMP0043 MMP0045 MMP0060 MMP0061 MMP0062 MMP0155 MMP0249 MMP0250 MMP0384 MMP0440 MMP0441 MMP0442 MMP0457 MMP1208 MMP1399 MMP1400 MMP1401 MMP1403 MMP1434 MMP1443 MMP1444 MMP1445 MMP1472 MMP1579 | idsA aIF6 rpl37ae rpoE2 aIF2_gamma ef1B rpl22p nusG P-loop guaA rps15p | isopentenyl pyrophosphate isomerase | bifunctional short chain isoprenyl diphosphate synthase | Ribosomal LX protein | translation initiation factor IF-6 | 50S ribosomal protein L31e | hypothetical protein | 50S ribosomal protein L37Ae | DNA-directed RNA polymerase subunit E' | DNA-directed RNA polymerase subunit E | Probable ATP dependent RNA helicase | translation initiation factor IF-2 subunit gamma | Aspartate/glutamate/uridylate kinase | elongation factor 1-beta | 50S ribosomal protein L22P | transcription antitermination protein NusG | GTP1/OBG family:ATP/GTP-binding site motif A (P-loop):TGS domain:Small GTP-binding protein domain | methionine aminopeptidase | GMP synthase subunit A | 30S ribosomal protein S15P |
| 62 | 24 | 38 | -17.788 | 0.465 | 
Residual = 0.465 |  | 
AAAGgTAAAaGGaaCATCtgcAag | 
TCgtgTTCCcaTTCcCG |  | MMP0324 MMP0343 MMP0485 MMP0486 MMP0508 MMP0552 MMP0662 MMP0665 MMP0700 MMP0743 MMP0744 MMP0745 MMP0746 MMP0747 MMP0748 MMP0749 MMP0750 MMP0776 MMP0777 MMP0960 MMP1280 MMP1650 Unanno_22 Unanno_43 | fmdE | hypothetical protein | molybdenum containing formylmethanofuran dehydrogenase, subunit E | transcriptional regulator PadR-like family | Probable integrase/recombinase | MCM family related protein | probable amino acid ABC transporter, periplasmic component |
| 63 | 12 | 37 | -23.945 | 0.157 | 
Residual = 0.157 |  | 
GCTaGGGcc | 
ACCTCC |  | MMP0156 MMP0952 MMP1148 MMP1360 MMP1362 MMP1371 MMP1406 MMP1543 MMP1544 MMP1545 MMP1658 Unanno_1 | aIF-5A Sm protein rpoH rpoB1 rps10p rpl3p rpl4lp rplW | 30S ribosomal protein S19e | translation initiation factor IF-5A | Small nuclear ribonucleoprotein (Sm protein) | DNA-directed RNA polymerase subunit H | DNA-directed RNA polymerase subunit B' | 30S ribosomal protein S10P | translation initiation factor Sui1 | 50S ribosomal protein L3P | 50S ribosomal protein L4P | 50S ribosomal protein L23 | 30S ribosomal protein S8e |
| 64 | 17 | 38 | -7.691 | 0.548 | 
Residual = 0.548 |  | 
TGGGCGaGG | 
gAtGAACGGAg |  | MMP0059 MMP0281 MMP0295 MMP0315 MMP0316 MMP0368 MMP0429 MMP0653 MMP0761 MMP0975 MMP1079 MMP1119 MMP1123 MMP1226 MMP1379 MMP1396 Unanno_10 | thrB iorB1 iorA1 modA yjlA thyA | hypothetical protein | Homoserine kinase | indolepyruvate oxidoreductase subunit B | indolepyruvate oxidoreductase subunit alpha 1 | Beta-Ig-H3/Fasciclin domain:hypothetical protein | sodium-dependent transporter | possible molybdenum ABC transporter, solute-binding protein | Glycosyl transferase, family 2 | thymidylate synthase | aminotransferase |
| 65 | 22 | 40 | -15.533 | 0.343 | 
Residual = 0.343 |  | 
CCtCCtGnAgAg | 
CCCAaAnaAAAgAT |  | MMP0070 MMP0241 MMP0254 MMP0276 MMP0570 MMP0642 MMP0643 MMP0753 MMP0764 MMP0765 MMP0770 MMP0915 MMP0916 MMP0991 MMP1029 MMP1053 MMP1054 MMP1636 MMP1684 Unanno_32 Unanno_34 Unanno_44 | cobY/cofC hdrB2 hdrC2 | tungsten containing formylmethanofruran dehydrogenase subunit C-related protein | hypothetical protein | probable ABC transporter | nucleoside triphosphate: 5'-deoxyadenosylcobinamide phosphate nucleotidyltransferase | heterodisulfide reductase; subunit B2 | heterodisulfide reductase; subunit C2 | General substrate transporter |
| 66 | 32 | 36 | -15.635 | 0.394 | 
Residual = 0.394 |  | 
TtTCTTttatAaaATCCCCG | 
GaTGCAGT |  | MMP0014 MMP0015 MMP0022 MMP0023 MMP0179 MMP0609 MMP0844 MMP0868 MMP0936 MMP0945 MMP1034 MMP1082 MMP1090 MMP1095 MMP1096 MMP1097 MMP1098 MMP1099 MMP1171 MMP1303 MMP1454 MMP1455 MMP1456 MMP1457 MMP1458 MMP1459 MMP1460 MMP1462 MMP1463 MMP1531 MMP1662 MMP1665 | truD purL pth2 proV aroE tmk hisH pstB pssA ehaG ehaH ehaI ehaJ ehaK ehaL ehaM ehaO ehaP cbiF | tRNA pseudouridine synthase D | hypothetical protein | Phosphoribosylformylglycinamidine synthase II | peptidyl-tRNA hydrolase | CBS domain:ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase | shikimate 5-dehydrogenase | glyceraldehyde-3-phosphate ferredoxin oxidoreductase | Thymidylate kinase | imidazole glycerol phosphate synthase subunit HisH | UDP-glucose 4-epimerase related | Phosphate-binding protein | Binding-protein-dependent transport systems inner membrane component | phosphate ABC transporter, ATP-binding protein | phosphate ABC transporter, regulatory protein | archaetidylserine synthase | Sensory transduction histidine kinase | putative transmembrane subunit of a hydrogenase | energy conserving hydrogenase A integral membrane subunit | energy conserving hydrogenase A large subunit | polyferredoxin | Precorrin-4 C11-methyltransferase |
| 67 | 30 | 38 | -10.729 | 0.380 | 
Residual = 0.380 |  | 
GGGCGA | 
CTGgGGAG |  | Antisense_6 MMP0017 MMP0035 MMP0108 MMP0124 MMP0202 MMP0203 MMP0204 MMP0227 MMP0262 MMP0274 MMP0280 MMP0322 MMP0341 MMP0446 MMP0488 MMP0489 MMP0617 MMP0648 MMP0682 MMP0760 MMP0811 MMP0993 MMP0994 MMP1079 MMP1120 MMP1123 MMP1346 MMP1686 Unanno_14 | Antisense_1 III nrdD hypE hisI rfcB pycA radB rtcA cbf5 | hypothetical protein | ABC-type Iron(III)-binding periplasmic protein precursor | Anaerobic Ribonucleoside-triphosphate reductase | hydrogenase expression/formation protein | Phosphoribosyl-AMP cyclohydrolase | replication factor C large subunit | pyruvate carboxylase subunit A | Nitrogen fixation-related protein | Low molecular weight phosphotyrosine protein phosphatase | DNA repair and recombination protein RadB | RNA 3'-terminal-phosphate cyclase | Glycosyl transferase, family 2 | ATP-binding protein, ATPase-like:Histidine kinase, HAMP region:Histidine kinase A, N-terminal:Bacterial sensor protein C-term... | Basic helix-loop-helix dimerization domain bHLH | H/ACA RNA-protein complex component Cbf5p |
| 68 | 25 | 37 | -16.814 | 0.371 | 
Residual = 0.371 |  | 
AAtTCACCgc | 
GtTTTTaTGTAGGTaAG |  | MMP0230 MMP0251 MMP0325 MMP0330 MMP0388 MMP0389 MMP0428 MMP0516 MMP0582 MMP0583 MMP0872 MMP0926 MMP0966 MMP1032 MMP1033 MMP1034 MMP1075 MMP1076 MMP1077 MMP1204 MMP1205 MMP1266 MMP1674 MMP1675 MMP1676 | psmA cbiC modD hemC cheB cobA rpa tmk dut aroA Gln flaH flaI flaJ | hypothetical protein | proteasome subunit alpha | glyceraldehyde-3-phosphate dehydrogenase | precorrin-8X methylmutase | geranylgeranyl bacterial chlorophyll reductase related | ferredoxin | vanadium nitrogenase-associated related protein N | molybdate transporter subunit | AzlC related protein | Porphobilinogen deaminase | chemotaxis protein CheB | uroporphyrin-III C-methyltransferase | replication factor A | Thymidylate kinase | dUTP diphosphatase | Bacterial transferase hexapeptide repeat:ADP-glucose pyrophosphorylase | Phosphoglucomutase/phosphomannomutase:Calcium- bin ding EF-hand | Metallopeptidase family M24:Xaa-Pro dipeptidase/Xaa-Pro aminopeptidase | 3-phosphoshikimate 1-carboxyvinyltransferase | glutamyl-tRNA(Gln) amidotransferase subunit D | flagellar accessory protein FlaH | flagella accessory protein I | flagellar assembly protein J |
| 69 | 17 | 40 | -21.831 | 0.208 | 
Residual = 0.208 |  | 
ggGgAnTnTttgGAA | 
CGCgAGtcG |  | MMP0032 MMP0090 MMP0517 MMP0518 MMP0586 MMP0587 MMP0741 MMP0774 MMP0786 MMP0796 MMP0842 MMP0957 MMP1125 MMP1285 MMP1377 MMP1631 Unanno_40 | napA dsbD | ArsR family member | Glycosyl transferase | hypothetical protein | uncharacterized endonuclease III related protein | Na+/H+ exchanger | probable sugar efflux transporter | PA-phosphatase related phosphoesterase |
| 70 | 40 | 36 | -11.336 | 0.490 | 
Residual = 0.490 |  | 
AGAtATgTagTgGTaAAAACA | 
cCgGtaaAAAAgTtTCCgAA |  | Antisense_3 MMP0183 MMP0220 MMP0270 MMP0272 MMP0273 MMP0274 MMP0345 MMP0371 MMP0382 MMP0385 MMP0397 MMP0398 MMP0399 MMP0400 MMP0402 MMP0448 MMP0449 MMP0450 MMP0451 MMP0498 MMP0500 MMP0618 MMP0619 MMP0620 MMP0816 MMP0898 MMP0899 MMP0900 MMP0904 MMP0949 MMP0954 MMP0966 MMP1022 MMP1089 MMP1093 MMP1129 MMP1137 MMP1138 MMP1139 | Antisense_1 ribB comA hypE pyrH alaS htpX ehbQ atwA P-loop selD cobA coaD ppiB thiM thiE | 3,4-dihydroxy-2-butanone 4-phosphate synthase | Sodium/proline symporter-related | hypothetical protein | ABC transporter ATPase subunit | (2R)-phospho-3-sulfolactate synthase | hydrogenase expression/formation protein | putative ATPase RIL | uridylate kinase | alanyl-tRNA synthetase | Peptidase family M48 | ferredoxin | Iron-sulfur flavoprotein-related | Putative DNA binding protein | methyl coenzyme M reductase, component A2 | bacterial seryl-tRNA synthetase related | Cellulose-binding, bacterial type | ATP/GTP-binding site motif A (P-loop) | Rhodanese-like | selenophosphate synthetase | tRNA CCA-pyrophosphorylase | uroporphyrin-III C-methyltransferase | Polysaccharide biosynthesis protein | phosphopantetheine adenylyltransferase | Peptidyl-prolyl cis-trans isomerase, cyclophilin type | Lrp-Like Transcriptional regulatory proteins, AsnC family | hydroxyethylthiazole kinase | thiamine-phosphate pyrophosphorylase |
| 71 | 21 | 39 | -19.310 | 0.307 | 
Residual = 0.307 |  | 
CagGgaagGGGG | 
CGccTggAtC |  | MMP0064 MMP0065 MMP0066 MMP0067 MMP0068 MMP0205 MMP0206 MMP0504 MMP0505 MMP0506 MMP0507 MMP0853 MMP0854 MMP0855 MMP0856 MMP0857 MMP0858 MMP0859 MMP0860 MMP1442 Unanno_6 | glnK1 amtB glnB glnK2 modA modB modC nifH NifI1 nifI2 nifD nifK nifE nifN nifX Unanno_1 | Nitrogen regulatory protein P-II | Ammonia transporter | molybdenum ABC transporter, periplasmic molybdenum-binding protein | molybdenum ABC transporter, permease protein | Molybdenum transport ATP-binding protein modC | hypothetical protein | molybdenum transport system permease protein, modB RELATED | molybdate-binding periplasmic protein; permease RELATED | nitrogenase reductase | Nitrogen regulatory protein NifI1 | Nitrogen regulatory protein NifI2 | Oxidoreductase, nitrogenase component 1 | nitrogenase iron-molybdenum cofactor biosynthesis protein | iron-molybdenum cofactor biosynthesis protein, subunit N | Nitrogen fixation-related protein | ArsR family transcriptional regulator |
| 72 | 37 | 39 | -18.343 | 0.275 | 
Residual = 0.275 |  | 
gAtAatCCCCtCg | 
GtTCcGCC |  | Antisense_16 MMP0071 MMP0423 MMP0435 MMP0436 MMP0475 MMP0484 MMP0485 MMP0513 MMP0515 MMP0518 MMP0551 MMP0662 MMP0690 MMP0740 MMP0766 MMP0767 MMP0773 MMP0778 MMP0779 MMP0780 MMP0781 MMP0782 MMP0789 MMP0790 MMP0800 MMP0801 MMP0832 MMP0834 MMP0957 MMP1015 MMP1184 MMP1281 MMP1339 MMP1571 MMP1678 Unanno_53 | rimK MoeA modB resP codB mtbA dsbD and some other nucleotide nfo | DNA primase, small subunit | hypothetical protein | putative SSU ribosomal protein S6 modification protein | possible sodium/proton antiporter | molybdopterin biosynthesis moeA protein | Molybdenum ABC transporter, permease protein | Binding-protein-dependent transport systems inner membrane component | polyferredoxin | possible purine NTPase | Site-specific recombinase | cytosine permease | Uroporphyrinogen decarboxylase (URO-D) | Transcription factor CBF/NF-Y/archaeal histone:Histone-fold/TFIID-TAF/NF-Y domain | N-acetyltransferase related protein | GCN5-related N-acetyltransferase | SAM (and some other nucleotide) binding motif | endonuclease IV |
| 73 | 17 | 39 | -16.019 | 0.268 | 
Residual = 0.268 |  | 
TaTCACCcCc | 
CagGGaAgTAtTGGA |  | MMP0128 MMP0182 MMP0311 MMP0312 MMP0313 MMP0456 MMP0520 MMP0559 MMP0678 MMP0691 MMP0848 MMP0976 MMP1227 MMP1387 MMP1683 Unanno_13 Unanno_30 | xerD-like cbiE | hypothetical protein | hypothetical protein protein: possibly conserved | Phage integrase | cation transport ATPase | Family of unknown function ThiJ/PfpI | protein methionine-S-oxide reductase | cobalt-precorrin-6Y C(5)-methyltransferase |
| 74 | 15 | 40 | -24.826 | 0.167 | 
Residual = 0.167 |  | 
CngCcCgc | 
GGGGGA |  | MMP0912 MMP0913 MMP0914 MMP0961 MMP0962 MMP0963 MMP1154 MMP1155 MMP1156 MMP1157 MMP1158 MMP1159 MMP1160 MMP1161 MMP1163 | hdrC1 hdrB1 rbo | tautomerase related protein | hypothetical protein | zinc finger protein | aquaporin related | heterosulfide reductase, subunit C1 | heterosulfide reductase, subunit B1 | Desulfoferrodoxin, ferrous iron-binding site | Ferritin | CutA1 divalent ion tolerance protein Related Protein |
| 75 | 25 | 39 | -14.695 | 0.320 | 
Residual = 0.320 |  | 
CCcCtCtg | 
AAAATAnccGA |  | MMP0008 MMP0009 MMP0113 MMP0119 MMP0235 MMP0236 MMP0237 MMP0239 MMP0240 MMP0241 MMP0392 MMP0452 MMP0453 MMP0458 MMP0595 MMP0635 MMP0636 MMP0723 MMP0725 MMP0909 MMP0934 MMP1141 MMP1162 MMP1220 MMP1295 | DP1 birA purD glgP | DNA polymerase II small subunit | putative DNA primase large subunit | hypothetical protein | Biotin--protein ligase | Phosphoribosylamine--glycine ligase | Neutral zinc metallopeptidase, zinc-binding region:CBS domain | ABC transporter:ATPase subunit | putative integral membrane protein | Lhr-like RNA helicase | Flavodoxin:Beta-lactamase-like | glycogen phosphorylase | glucose-6-phosphate isomerase |
| 76 | 19 | 37 | -17.924 | 0.235 | 
Residual = 0.235 |  | 
CAGtTtTTCc | 
cGGGCA |  | MMP0002 MMP0054 MMP0055 MMP0269 MMP0527 MMP0630 MMP0678 MMP0885 MMP0995 MMP1002 MMP1003 MMP1004 MMP1005 MMP1006 MMP1007 MMP1008 MMP1598 MMP1599 Unanno_55 | feoB P-loop trpA trpB trpF trpG trpE trpD trpC trkA | L-seryl-tRNA selenium transferase related protein | hypothetical protein | ferrous iron transporter (GTP-binding) | TPR repeat:ATP/GTP-binding site motif A (P-loop) | tryptophan synthase subunit alpha | tryptophan synthase subunit beta | N-(5'-phosphoribosyl)anthranilate isomerase | anthranilate synthase component II | anthranilate synthase component I | Anthranilate phosphoribosyltransferase | indole-3-glycerol-phosphate synthase | Trk system potassium uptake protein A |
| 77 | 30 | 37 | -10.657 | 0.397 | 
Residual = 0.397 |  | 
CACCTC | 
CGGGGGGcT |  | MMP0003 MMP0006 MMP0062 MMP0103 MMP0127 MMP0135 MMP0136 MMP0249 MMP0250 MMP0261 MMP0317 MMP0370 MMP0391 MMP0396 MMP0553 MMP0654 MMP1013 MMP1035 MMP1036 MMP1149 MMP1310 MMP1311 MMP1497 MMP1498 MMP1510 MMP1515 MMP1588 MMP1593 MMP1699 Unanno_19 | korA hmd thrC leuD rpl37ae aspC eno argF ilvC carB leuC purO gatA hsp60 serA | 2-oxoglutarate ferredoxin oxidoreductase subunit alpha | 3-dehydroquinate synthase | 50S ribosomal protein L31e | pyridoxine biosynthesis protein | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase | threonine synthase | 3-isopropylmalate dehydratase small subunit | 50S ribosomal protein L37Ae | hypothetical protein | DNA directed RNA polymerase; subunit L | Aspartate aminotransferase | Enolase | Ornithine carbamoyltransferase | ketol-acid reductoisomerase | Carbamoyl-phosphate synthase large chain | Band 7 protein:Stomatin | 3-isopropylmalate dehydratase | IMP cyclohydrolase | ferredoxin | aspartyl/glutamyl-tRNA amidotransferase subunit A | Chaperonin GroEL (thermosome, HSP60 family) | D-3-phosphoglycerate dehydrogenase |
| 78 | 27 | 38 | -12.102 | 0.386 | 
Residual = 0.386 |  | 
GTTTTgAcCaGCAC | 
gTATAacgtATAnaTataGGTagg |  | MMP0290 MMP0308 MMP0309 MMP0355 MMP0359 MMP0377 MMP0381 MMP0382 MMP0385 MMP0391 MMP0396 MMP0397 MMP0399 MMP0400 MMP0410 MMP0500 MMP0704 MMP1023 MMP1116 MMP1129 MMP1137 MMP1138 MMP1139 MMP1352 MMP1589 Unanno_33 Unanno_8 | nac pyrH aspC eno alaS htpX ehbQ prsA ppiB thiM thiE carA Unanno_1 | nascent polypeptide-associated complex protein | hypothetical protein | intracellular sulfur reduction related protein | Glycosyl transferase, family 2 | isoleucyl-tRNA synthetase related | 3-isopropylmalate dehydratase small subunit Related | putative ATPase RIL | uridylate kinase | Aspartate aminotransferase | Enolase | alanyl-tRNA synthetase | Peptidase family M48 | ribose-phosphate pyrophosphokinase | Iron-sulfur flavoprotein-related | ParA type ATPase | Transcriptional regulator, TetR Family Member | endoglucanase | Peptidyl-prolyl cis-trans isomerase, cyclophilin type | Lrp-Like Transcriptional regulatory proteins, AsnC family | hydroxyethylthiazole kinase | thiamine-phosphate pyrophosphorylase | putative thiazole biosynthetic enzyme | carbamoyl phosphate synthase small subunit |
| 79 | 8 | 39 | -48.532 | 0.081 | 
Residual = 0.081 |  | 
GGAAAACCcTtTGGAG | 
ACcTtcagttcAtcC |  | MMP0156 MMP0157 MMP0627 MMP1365 MMP1366 MMP1367 MMP1368 MMP1369 | rpl34e nusA rps12P aEF-2 | 30S ribosomal protein S19e | hypothetical protein | 50S ribosomal protein L34e | 50S ribosomal protein L30e | transcription elongation factor NusA | 30S ribosomal protein S12P | 30S ribosomal protein S7P | elongation factor EF-2 |
| 80 | 23 | 37 | -19.012 | 0.346 | 
Residual = 0.346 |  | 
TcCACCAAatCCgcaaT | 
TACaACACATaTgAAgTaAAaACA |  | Antisense_4 MMP0285 MMP0287 MMP0349 MMP0350 MMP0351 MMP0352 MMP0353 MMP0354 MMP0356 MMP0381 MMP0393 MMP0398 MMP0401 MMP0705 MMP0911 MMP0920 MMP1094 MMP1286 MMP1287 MMP1288 MMP1315 MMP1587 | Antisense_1 Component A aspB-like1 metE wbpI ahcY ppsA korG | Phosphoesterase, RecJ-like:TrkA-N:Phosphoesterase, DHHA1 | hypothetical protein | 2-hydroxyglutaryl-CoA dehydratase (Component A) related protein | Bacterial transferase hexapeptide repeat | DegT/DnrJ/EryC1/StrS aminotransferase | Putative oxidoreductase | UDP-glucose/GDP-mannose dehydrogenase Related protein | putative oligosaccharide transporter | Glycosyl transferase, group 1 | 3-isopropylmalate dehydratase small subunit Related | phosphoesterase-like protein | methionine synthase | UDP-N-acetylglucosamine 2-epimerase | related to iron-sulfur flavoprotein of Methanosarcina thermophila | S-adenosyl-L-homocysteine hydrolase | phosphoenolpyruvate synthase | DNA primase | 2-oxoglutarate ferredoxin oxidoreductase subunit gamma |
| 81 | 18 | 37 | -15.758 | 0.261 | 
Residual = 0.261 |  | 
GGTGAtTT | 
gggTTTTacgTtG |  | MMP0212 MMP0297 MMP0414 MMP0550 MMP0588 MMP0596 MMP0597 MMP0899 MMP0900 MMP0946 MMP1063 MMP1068 MMP1105 MMP1106 MMP1131 MMP1242 MMP1353 MMP1427 | aIF-2_beta thrS dph5 NOP5/NOP56 flpA P-loop gatB leuA sucC nadA | glycyl-tRNA synthetase | translation initiation factor IF-2 subunit beta | threonyl-tRNA synthetase | similar to ABC-type amino acid transport system, periplasmic component | diphthine synthase | RNA 2'-O-methyl modification protein (NOP5/NOP56) | fibrillarin | ATP/GTP-binding site motif A (P-loop) | Rhodanese-like | aspartyl/glutamyl-tRNA amidotransferase subunit B | 2-isopropylmalate synthase | K+-dependent Na+/Ca+ exchanger related-protein:Sodium/calcium exchanger membrane region | succinate-CoA ligase (ADP-forming), beta chain | hypothetical protein | peptide chain release factor 1 | quinolinate synthetase |
| 82 | 16 | 38 | -20.157 | 0.186 | 
Residual = 0.186 |  | 
GGGGat | 
TcGGGC |  | Antisense_17 MMP0110 MMP0196 MMP0198 MMP0201 MMP0208 MMP0436 MMP0437 MMP0475 MMP0497 MMP0501 MMP0740 MMP0831 MMP0838 MMP1172 MMP1678 | III moeA rimK mtbA nfo | ABC transporter:AAA ATPase | ABC-type iron(III) transport system, periplasmic binding protein | ABC-type iron(III) transport system, ATP binding protein | Molybdenum cofactor biosynthesis protein | hypothetical protein | putative SSU ribosomal protein S6 modification protein | possible purine NTPase | methylcobalamin:coenzyme M methyltransferase | endonuclease IV |
| 83 | 24 | 39 | -11.739 | 0.357 | 
Residual = 0.357 |  | 
TtCgCCccg | 
CCTgCACC |  | MMP0129 MMP0177 MMP0283 MMP0421 MMP0422 MMP0585 MMP0660 MMP0692 MMP0848 MMP0940 MMP0976 MMP1058 MMP1118 MMP1221 MMP1227 MMP1250 MMP1397 MMP1428 MMP1551 MMP1568 MMP1569 MMP1607 MMP1720 MMP1721 | ndk Usp apt and some other nucleotide cbiE smc1 ffh | hypothetical protein | Nucleoside-diphosphate kinase | conserved archael hypothetical protein | Universal stress protein (Usp) | adenine phosphoribosyltransferase | protein methionine-S-oxide reductase | related to ehbP of Methanothermobacter thermautotrophicus | SAM (and some other nucleotide) binding motif | cobalt-precorrin-6Y C(5)-methyltransferase | 6-pyruvoyl tetrahydropterin synthase | structural maintenance of chromosome protein | signal recognition particle protein Srp54 |
| 84 | 10 | 39 | -24.568 | 0.106 | 
Residual = 0.106 |  | 
| 
|  | MMP0913 MMP0914 MMP1154 MMP1155 MMP1156 MMP1157 MMP1158 MMP1159 MMP1160 MMP1161 | hdrC1 hdrB1 rbo | hypothetical protein | heterosulfide reductase, subunit C1 | heterosulfide reductase, subunit B1 | Desulfoferrodoxin, ferrous iron-binding site | Ferritin |
| 85 | 30 | 37 | -11.499 | 0.380 | 
Residual = 0.380 |  | 
cAGttGCgGgAagGA | 
gTtAGGGG |  | Antisense_1 MMP0018 MMP0140 MMP0161 MMP0211 MMP0424 MMP0454 MMP0459 MMP0478 MMP0512 MMP0517 MMP0522 MMP0523 MMP0538 MMP0565 MMP0731 MMP0789 MMP0794 MMP0807 MMP0828 MMP0835 MMP0892 MMP1125 MMP1173 MMP1179 MMP1180 MMP1268 MMP1423 MMP1501 MMP1535 | comB fmdB codB and some other nucleotide | Transcriptional regulator, LysR Family Member | hypothetical protein | 2-phosphosulfolactate phosphatase | molybdenum containing formylmethanofuran dehydrogenase, subunit B | ABC transporter ATP-binding protein | exodeoxyribonuclease VII small subunit | cytosine permease | Carboxymuconolactone decarboxylase Related Protein | acetyltransferase related protein | SAM (and some other nucleotide) binding motif:Generic methyltransferase | putative glycosyl transferase, family 4:Aldehyde dehydrogenase |
| 86 | 19 | 38 | -19.153 | 0.272 | 
Residual = 0.272 |  | 
AaCGagGGgga | 
GGCcTTGGCc |  | MMP0100 MMP0160 MMP0285 MMP0287 MMP0340 MMP0341 MMP0590 MMP0713 MMP0714 MMP0715 MMP0814 MMP0815 MMP0910 MMP0919 MMP1128 MMP1196 MMP1222 Unanno_2 Unanno_4 | ftsA-2 pycB pycA iorA2 iorB2 ppiB radA Unanno_1 | Na+/H+ exchanger family | coenzyme F390 synthetase | Phosphoesterase, RecJ-like:TrkA-N:Phosphoesterase, DHHA1 | hypothetical protein | pyruvate carboxylase subunit B | pyruvate carboxylase subunit A | Glycosyl transferase, family 2 | indolepyruvate oxidoreductase subunit alpha 2 | indolepyruvate oxidoreductase subunit B | coenzyme F390 synthetase II | dihydroorotate dehydrogenase electron transfer subunit | Peptidyl-prolyl cis-trans isomerase, cyclophilin type | DNA repair and recombination protein RadA |
| 87 | 23 | 38 | -17.882 | 0.234 | 
Residual = 0.234 |  | 
CCccCaATCcGGC | 
CaccTGcTGAG |  | Antisense_4 MMP0033 MMP0036 MMP0092 MMP0155 MMP0246 MMP0247 MMP0248 MMP0316 MMP0384 MMP0398 MMP0403 MMP0404 MMP0412 MMP0603 MMP0604 MMP0671 MMP0707 MMP0878 MMP1425 MMP1480 MMP1582 MMP1710 | Antisense_1 tfe rpoF iorA1 cofD aIF-1A ywbE pdaD | LysR family member | transcription initiation factor E subunit alpha | DNA-directed RNA polymerase subunit F | hypothetical protein | ribosomal biogenesis protein | DNA-directed RNA polymerase related protein | indolepyruvate oxidoreductase subunit alpha 1 | LPPG:FO 2-phospho-(S)-lactate transferase | translation initiation factor IF-1A | Na+/H+ exchanger | Ribonuclease P-related protein | tRNA 2'-O-methylase | aconitase Family | pyruvoyl-dependent arginine decarboxylase |
| 88 | 16 | 39 | -41.180 | 0.211 | 
Residual = 0.211 |  | 
gcagaGGTaGttnAGcCTG | 
CgggGTccaAcTcCctgcCcgcgC |  | RNA_13 RNA_16 RNA_2 RNA_20 RNA_21 RNA_22 RNA_23 RNA_24 RNA_26 RNA_27 RNA_3 RNA_5 RNA_50 RNA_7 RNA_8 RNA_9 | tRNA-Ser1 tRNA-Ser2 tRNA-Ala2 tRNA-Phe1 tRNA-Asn1 tRNA-Met2 tRNA-Glu2 tRNA-Leu2 tRNA-Leu3 tRNA-Val2 tRNA-SeC1 | tRNA-Ser | tRNA-Ala | tRNA-Phe | tRNA-Asn | tRNA-Met | tRNA-Glu | tRNA-Leu | tRNA-Val | tRNA-Sec |
| 89 | 31 | 35 | -23.782 | 0.417 | 
Residual = 0.417 |  | 
AgTATaTAtAtnTTaCtATTTgAa | 
GAtAaCGtTAgCAAaCCT |  | MMP0407 MMP0571 MMP0866 MMP0867 MMP1095 MMP1096 MMP1097 MMP1098 MMP1099 MMP1210 MMP1211 MMP1212 MMP1213 MMP1243 MMP1244 MMP1245 MMP1246 MMP1247 MMP1248 MMP1249 MMP1441 MMP1555 MMP1556 MMP1557 MMP1558 MMP1559 MMP1609 MMP1652 Unanno_12 Unanno_21 Unanno_56 | moaA proX pstB fwdH fwdF fwdG fwdD fwdA fwdC mobB mcrB mcrD mcrC mcrG mcrA ftr | hypothetical protein | molybdenum cofactor biosynthesis protein A | putative glycine betaine/L-proline ABC transporter, solute-binding protein | ABC-type proline/glycine betaine transport system, permease component related protein | Phosphate-binding protein | Binding-protein-dependent transport systems inner membrane component | phosphate ABC transporter, ATP-binding protein | phosphate ABC transporter, regulatory protein | acetyl-CoA acetyltransferase | tungsten containing formylmethanofuran dehydrogenase, subunit H | tungsten containing formylmethanofuran dehydrogenase, subunit F | tungsten containing formylmethanofuran dehydrogenase, subunit G | tungsten containing formylmethanofuran dehydrogenase, subunit D | tungsten containing formylmethanofuran dehydrogenase, subunit A | tungsten containing formylmethanofuran dehydrogenase, subunit C | ATP/GTP-binding site motif A (P-loop):Molybdopterin-guanine dinucleotide biosynthesis protein | Methyl-coenzyme M reductase I, beta subunit | Methyl-coenzyme M reductase I, protein D | methyl coenzyme M reductase I, protein C | Methyl-coenzyme M reductase I, gamma subunit | Methyl-coenzyme M reductase I, alpha subunit | tetrahydromethanopterin formyltransferase |
| 90 | 33 | 37 | -12.595 | 0.454 | 
Residual = 0.454 |  | 
GGGGGGAT | 
CcACcAAtAtATCtAGTAgC |  | Antisense_24 MMP0277 MMP0278 MMP0279 MMP0280 MMP0295 MMP0302 MMP0321 MMP0344 MMP0434 MMP0476 MMP0477 MMP0533 MMP0622 MMP0658 MMP0725 MMP0728 MMP0729 MMP0735 MMP0791 MMP0996 MMP0997 MMP1100 MMP1164 MMP1165 MMP1166 MMP1167 MMP1224 MMP1553 MMP1633 Unanno_42 Unanno_52 Unanno_62 | mptG hisI thrB draG uvrC uvrA type 1 rdxA | TraB family | hypothetical protein | beta-ribofuranosylaminobenzene 5'-phosphate synthase | Phosphoribosyl-AMP cyclohydrolase | Homoserine kinase | ADP-ribosylglycohydrolase (draG) homolog | MoaA/nifB/pqqE family | putative integral membrane protein | excinuclease ABC subunit C | excinuclease ABC subunit A | N-6 Adenine-specific DNA methylase:N6 adenine-specific DNA methyltransferase, D12 class | Transcriptional regulator, TetR Family Member | Blue (type 1) copper domain | putative transcriptional regulator | heavy-metal transport ATPase related protein | Haloacid dehalogenase/epoxide hydrolase:ATPase, E1-E2 type:Heavy metal transport/detoxification protein | related to iron-sulfur flavoprotein of Methanosarcina thermophila | flavoprotein related protein | ABC-type amino acid transport/signal transduction systems periplasmic component-related | Nitroreductase family |
| 91 | 8 | 36 | -26.229 | 0.083 | 
Residual = 0.083 |  | 
| 
|  | MMP0156 MMP0157 MMP0158 MMP1365 MMP1366 MMP1367 MMP1368 MMP1369 | nusA rps12P aEF-2 | 30S ribosomal protein S19e | hypothetical protein | 50S ribosomal protein L30e | transcription elongation factor NusA | 30S ribosomal protein S12P | 30S ribosomal protein S7P | elongation factor EF-2 |
| 92 | 33 | 39 | -11.417 | 0.408 | 
Residual = 0.408 |  | 
CCGGTGat | 
GGCGCgAgCC |  | MMP0026 MMP0036 MMP0043 MMP0099 MMP0134 MMP0405 MMP0457 MMP0530 MMP0566 MMP0639 MMP0640 MMP0641 MMP0682 MMP0695 MMP0760 MMP0943 MMP0975 MMP1211 MMP1289 MMP1319 MMP1361 MMP1379 MMP1380 MMP1381 MMP1396 MMP1400 MMP1403 MMP1443 MMP1444 MMP1480 MMP1511 MMP1543 MMP1710 | DP2 tfe gch3 rps28e rpl7ae psmB taqD modA rpl10e rps13p rpoB2 thyA P-loop rpl22p rpl3p | DNA polymerase II large subunit | transcription initiation factor E subunit alpha | isopentenyl pyrophosphate isomerase | General substrate transporter | hypothetical protein | GTP cyclohydrolase III | Probable ATP dependent RNA helicase | acyl-CoA synthetase | LSU ribosomal protein L23E | 30S ribosomal protein S28e | 50S ribosomal protein L7Ae | proteasome, subunit beta | glycerol-3-phosphate cytidyltransferase | possible molybdenum ABC transporter, solute-binding protein | 50S ribosomal protein L10e | 30S ribosomal protein S13P | DNA-directed RNA polymerase subunit beta'' | thymidylate synthase | chlorohydrolase | Beta-lactamase-like:ATP/GTP-binding site motif A (P-loop) | aminotransferase | 50S ribosomal protein L22P | GTP1/OBG family:ATP/GTP-binding site motif A (P-loop):TGS domain:Small GTP-binding protein domain | methionine aminopeptidase | aconitase Family | Sodium:alanine symporter | 50S ribosomal protein L3P |
| 93 | 15 | 38 | -31.332 | 0.182 | 
Residual = 0.182 |  | 
cnGTgGtttAGccTG | 
CCtGCnattgg |  | RNA_1 RNA_10 RNA_11 RNA_12 RNA_15 RNA_18 RNA_21 RNA_25 RNA_28 RNA_29 RNA_30 RNA_32 RNA_35 RNA_4 Unanno_41 | tRNA-Ala2 tRNA-Arg1 tRNA-Glu1 tRNA-Val1 tRNA-Arg3 tRNA-Ile1 tRNA-Asn1 tRNA-His1 tRNA-Cys1 tRNA-Gly1 tRNA-Gly2 tRNA-Ser3 tRNA-Thr2 | tRNA-Ala | tRNA-Arg | tRNA-Glu | tRNA-Val | tRNA-Ile | tRNA-Asn | tRNA-His | tRNA-Cys | tRNA-Gly | tRNA-Ser | tRNA-Thr |
| 94 | 18 | 40 | -24.382 | 0.250 | 
Residual = 0.250 |  | 
tagATaaAGgGGgaAgAa | 
AgCGTTcTaGATAtTtcatAC |  | MMP0117 MMP0276 MMP0312 MMP0327 MMP0336 MMP0337 MMP0431 MMP0432 MMP0433 MMP0548 MMP0549 MMP0660 MMP0677 MMP1145 MMP1241 MMP1372 MMP1548 MMP1549 | deoA hjc hisB apt minD manB | hypothetical protein | thymidine phosphorylase | Archaeal Holliday junction resolvase | Rhodopsin-like GPCR superfamily:Beta-lactamase-like | putative flavodoxin | Imidazoleglycerol-phosphate dehydratase | adenine phosphoribosyltransferase | Septum formation inhibitor-activating ATPase | Phosphoglucomutase/phosphomannomutase | Fe-S type hydro-lyase tartrate/fumarate beta region | AP endonuclease, family 2 |
| 95 | 33 | 40 | -7.404 | 0.564 | 
Residual = 0.564 |  | 
GGCCAAGGCc | 
CGAGGGAtgTG |  | MMP0104 MMP0108 MMP0178 MMP0216 MMP0253 MMP0271 MMP0354 MMP0479 MMP0849 MMP0861 MMP0862 MMP0873 MMP0999 MMP1000 MMP1099 MMP1150 MMP1199 MMP1210 MMP1212 MMP1219 MMP1232 MMP1337 MMP1429 MMP1466 MMP1612 MMP1651 MMP1652 Unanno_12 Unanno_24 Unanno_28 Unanno_49 Unanno_5 Unanno_60 | III purQ acd kamA yodP mtaA rpm ehaS modA Unanno_1 | polyferredoxin | ABC-type Iron(III)-binding periplasmic protein precursor | Phosphoribosylformylglycinamidine synthase I | cation transport ATPase | acetyl-CoA synthetase (ADP-forming), alpha and beta subunits | ATP binding putative nickel incorporation protein | putative oligosaccharide transporter | hypothetical protein | L-lysine/ homoserine-homoserine lactone exporter family | Lysine 2,3-aminomutase | GCN5-related N-acetyltransferase | TPR repeat | phosphate ABC transporter, regulatory protein | Uroporphyrinogen decarboxylase (URO-D) | phosphate transport system regulatory protein-related | acetyl-CoA acetyltransferase | putative dinG ATP-dependent helicase | hydrogenase maturation protease, related | Transcription factor TFIIS:DNA-directed RNA polymerase, M/15 kDa subunit | periplasmic molybdate-binding protein |
| 96 | 27 | 40 | -13.741 | 0.310 | 
Residual = 0.310 |  | 
gAGGTGc | 
CCcTGCc |  | MMP0060 MMP0061 MMP0062 MMP0075 MMP0163 MMP0242 MMP0245 MMP0317 MMP0350 MMP0370 MMP0443 MMP0572 MMP0578 MMP0657 MMP0668 MMP0946 MMP1013 MMP1113 MMP1147 MMP1208 MMP1254 MMP1260 MMP1401 MMP1403 MMP1433 MMP1515 MMP1646 | aIF6 arsA pfdB rps24e slyD aroQ gatB carB rpl37e aIF2_gamma purM ef1B rpl22p hsp60 | Ribosomal LX protein | translation initiation factor IF-6 | 50S ribosomal protein L31e | hypothetical protein | Putative arsenical pump-driving ATPase | Prefoldin beta subunit (GimC beta subunit). | Bacterial transferase hexapeptide repeat | 30S ribosomal protein S24e | Peptidylprolyl isomerase, FKBP-type | chorismate mutase | aspartyl/glutamyl-tRNA amidotransferase subunit B | Carbamoyl-phosphate synthase large chain | transketoloase, C terminal half | 50S ribosomal protein L37e | translation initiation factor IF-2 subunit gamma | phosphoribosylaminoimidazole synthetase | elongation factor 1-beta | 50S ribosomal protein L22P | Ribosomal protein L11 | Chaperonin GroEL (thermosome, HSP60 family) |
| 97 | 9 | 40 | -39.928 | 0.104 | 
Residual = 0.104 |  | 
TCagCTACTTaggCGG | 
AcCGTgcatAG |  | MMP0443 MMP0444 MMP1400 MMP1401 MMP1402 MMP1403 MMP1404 MMP1405 MMP1433 | rps24e ef1B rpl22p rps3p rpmC | 30S ribosomal protein S24e | 30S ribosomal protein S27ae | hypothetical protein | elongation factor 1-beta | 50S ribosomal protein L22P | 30S ribosomal protein S3P | 50S ribosomal protein L29 | Ribosomal protein L11 |
| 98 | 24 | 40 | -17.858 | 0.321 | 
Residual = 0.321 |  | 
ACCTAcAtAAAaAc | 
cgCGgttATCgGGgG |  | MMP0050 MMP0051 MMP0342 MMP0413 MMP0487 MMP0922 MMP0923 MMP0924 MMP0925 MMP0926 MMP0927 MMP0928 MMP0929 MMP0930 MMP0931 MMP0932 MMP0933 MMP0945 MMP1230 MMP1231 MMP1674 MMP1675 MMP1676 MMP1719 | ribH hisE dapB cheW cheB cheA cheD MCP cheR cheY flaH flaI flaJ | riboflavin synthase subunit beta | phosphoribosyl-ATP pyrophosphatase | hypothetical protein | possible phage infection protein | dihydrodipicolinate reductase | chemotaxis protein CheW | chemotaxis protein CheB | Chemotaxis protein CheA | chemotaxis protein CheD | Methyl-accepting chemotaxis protein (MCP) | chemotaxis protein CheR | probable chemotaxis-related protein | chemotaxis protein CheY | glyceraldehyde-3-phosphate ferredoxin oxidoreductase | DNA polymerase, beta-like region | putative HAD family hydrolase, a fragment | flagellar accessory protein FlaH | flagella accessory protein I | flagellar assembly protein J |
| 99 | 28 | 35 | -14.172 | 0.480 | 
Residual = 0.480 |  | 
CGcaGtTTcCcCTACgGcTAC | 
cgTTatctTTttGaTAgGGgCg |  | MMP0064 MMP0065 MMP0066 MMP0067 MMP0068 MMP0204 MMP0205 MMP0456 MMP0480 MMP0514 MMP0853 MMP0854 MMP0855 MMP0856 MMP0857 MMP0858 MMP0859 MMP0860 MMP1033 MMP1049 MMP1091 MMP1206 MMP1388 MMP1390 MMP1442 MMP1576 Unanno_47 Unanno_6 | glnK1 amtB glnB glnK2 modA xerD-like nifH NifI1 nifI2 nifD nifK nifE nifN nifX glnA Unanno_1 | Nitrogen regulatory protein P-II | Ammonia transporter | hypothetical protein | molybdenum ABC transporter, periplasmic molybdenum-binding protein | Phage integrase | Molybdenum ABC transporter, periplasmic molybdenum-binding protein | nitrogenase reductase | Nitrogen regulatory protein NifI1 | Nitrogen regulatory protein NifI2 | Oxidoreductase, nitrogenase component 1 | nitrogenase iron-molybdenum cofactor biosynthesis protein | iron-molybdenum cofactor biosynthesis protein, subunit N | Nitrogen fixation-related protein | related to ehbB of Methanothermobacter thermautotrophicus | ADP-glucose pyrophosphorylase | glutamine synthetase | Redox-active disulfide protein 2 | ArsR family transcriptional regulator |
| 100 | 39 | 38 | -15.678 | 0.377 | 
Residual = 0.377 |  | 
CAGgCTannCtACctc | 
caGGGTTCgaAtCCCngagaccgc |  | Mma-sR04 MMP0509 MMP1330 MMP1525 MMP1586 RNA_11 RNA_13 RNA_14 RNA_16 RNA_17 RNA_18 RNA_2 RNA_20 RNA_22 RNA_23 RNA_24 RNA_26 RNA_28 RNA_3 RNA_30 RNA_33 RNA_34 RNA_37 RNA_45 RNA_46 RNA_47 RNA_48 RNA_49 RNA_5 RNA_6 RNA_7 RNA_8 RNA_9 Unanno_11 Unanno_16 Unanno_21 Unanno_26 Unanno_35 Unanno_54 | fmdA HUPF/HYPC tRNA-Glu1 tRNA-Ser1 tRNA-Arg2 tRNA-Ser2 tRNA-Pro2 tRNA-Ile1 tRNA-Ala2 tRNA-Phe1 tRNA-Met2 tRNA-Glu2 tRNA-Leu2 tRNA-Leu3 tRNA-Cys1 tRNA-Gly2 tRNA-Met3 tRNA-Met4 rrnD5S rrnA5S rrnB5S rnnC5S | formylmethanofuran dehydrogenase, subunit A | Hydrogenase expression/formation protein (HUPF/HYPC) | Modulator of DNA gyrase | hypothetical protein | tRNA-Glu | tRNA-Ser | tRNA-Arg | tRNA-Pro | tRNA-Ile | tRNA-Ala | tRNA-Phe | tRNA-Met | tRNA-Leu | tRNA-Cys | tRNA-Gly | 5S ribosomal RNA |
| 101 | 37 | 39 | -15.593 | 0.351 | 
Residual = 0.351 |  | 
CAGGCTgGaCtAcC | 
gaCacttTTcaAAGGttnac |  | MMP0139 MMP0254 MMP0459 MMP0509 MMP0512 MMP1684 RNA_1 RNA_13 RNA_14 RNA_16 RNA_19 RNA_2 RNA_20 RNA_22 RNA_23 RNA_24 RNA_26 RNA_27 RNA_3 RNA_31 RNA_43 RNA_45 RNA_46 RNA_47 RNA_48 RNA_49 RNA_5 RNA_6 RNA_7 RNA_8 Unanno_11 Unanno_23 Unanno_27 Unanno_34 Unanno_35 Unanno_48 Unanno_54 | fdhB fmdA fmdB tRNA-Ala2 tRNA-Ser1 tRNA-Arg2 tRNA-Ser2 tRNA-Met1 tRNA-Phe1 tRNA-Met2 tRNA-Glu2 tRNA-Leu2 tRNA-Leu3 tRNA-Val2 tRNA-Ala1 tRNA-Trp rrnA5S rrnB5S rnnC5S | formate dehydrogenase beta subunit | hypothetical protein | formylmethanofuran dehydrogenase, subunit A | molybdenum containing formylmethanofuran dehydrogenase, subunit B | tRNA-Ala | tRNA-Ser | tRNA-Arg | tRNA-Met | tRNA-Phe | tRNA-Glu | tRNA-Leu | tRNA-Val | tRNA-Trp | 5S ribosomal RNA |
| 102 | 17 | 41 | -22.085 | 0.191 | 
Residual = 0.191 |  | 
TAAAtCTaTcAAAc | 
TCacggATTCaC |  | MMP0122 MMP0425 MMP0426 MMP0465 MMP0534 MMP0535 MMP0569 MMP0958 MMP0959 MMP1001 MMP1052 MMP1060 MMP1124 MMP1282 MMP1283 MMP1514 MMP1598 | trxB cysS tyrA | hypothetical protein | Nitroreductase family | thioredoxin reductase | cysteinyl-tRNA synthetase | AIR synthase related protein | prephenate dehydrogenase |
| 103 | 12 | 37 | -30.198 | 0.158 | 
Residual = 0.158 |  | 
GGAGGC | 
GcGCcgagggG |  | MMP0258 MMP1319 MMP1320 MMP1322 MMP1323 MMP1324 MMP1325 MMP1326 MMP1327 MMP1328 MMP1363 MMP1364 | rpl12p rps13p rps4p rpoD rpl13p rps9p rpoN rpoK rpoA1 rpoA2 | 50S ribosomal protein L12P | 30S ribosomal protein S13P | 30S ribosomal protein S4 | DNA-directed RNA polymerase, subunit D | 50S ribosomal protein L18e | 50S ribosomal protein L13P | 30S ribosomal protein S9P | DNA-directed RNA polymerase subunit N | DNA-directed RNA polymerase, subunit K | Enolase | DNA-directed RNA polymerase subunit alpha | DNA-directed RNA polymerase subunit A'' |
| 104 | 30 | 36 | -13.777 | 0.346 | 
Residual = 0.346 |  | 
tgtAAtnGtTccTGg | 
cCCCCG |  | Antisense_1 MMP0011 MMP0019 MMP0077 MMP0125 MMP0126 MMP0161 MMP0170 MMP0186 MMP0214 MMP0218 MMP0236 MMP0379 MMP0380 MMP0392 MMP0731 MMP0895 MMP0909 MMP0986 MMP1027 MMP1202 MMP1203 MMP1232 MMP1264 MMP1350 MMP1377 MMP1485 MMP1494 MMP1600 Unanno_59 | flpA bioB comB cofF dnaB purD thyA cbiD moaB glutaminyl transferase | C-5 cytosine-specific DNA methylase | hypothetical protein | conserved archaeal fibrillarin homolog | biotin synthase | 2-phosphosulfolactate phosphatase | gamma-F420-2:alpha-L-glutamate ligase | nucleotide triphosphatase | DNA polymerase family B | Phosphoribosylamine--glycine ligase | exodeoxyribonuclease VII small subunit | TPR repeat | thymidylate synthase | cobalt-precorrin-6A synthase | Molybdenum cofactor biosynthesis protein | Ribosomal protein S6 modification enzyme (glutaminyl transferase) related |
| 105 | 14 | 39 | -27.141 | 0.148 | 
Residual = 0.148 |  | 
TTTgGAGG | 
gGcGtAtGggTtGAAAatggA |  | MMP0159 MMP0625 MMP0667 MMP0668 MMP0669 MMP1207 MMP1289 MMP1321 MMP1400 MMP1401 MMP1402 MMP1403 MMP1404 MMP1433 | rpl39e rps2P rpl10e rps11p ef1B rpl22p rps3p | 50S ribosomal protein L39e | 50S ribosomal protein L14e | 30S ribosomal protein S2 | hypothetical protein | 30S ribosomal protein S3Ae | 30S ribosomal protein S6e | 50S ribosomal protein L10e | 30S ribosomal protein S11P | elongation factor 1-beta | 50S ribosomal protein L22P | 30S ribosomal protein S3P | Ribosomal protein L11 |
| 106 | 37 | 39 | -15.544 | 0.342 | 
Residual = 0.342 |  | 
CGAGTAAACCGGATAGCTTAC | 
TGaagGGCaGtggcA |  | MMP0001 MMP0002 MMP0030 MMP0084 MMP0085 MMP0091 MMP0239 MMP0420 MMP0425 MMP0426 MMP0531 MMP0535 MMP0598 MMP0605 MMP0630 MMP0808 MMP0809 MMP0958 MMP0959 MMP0969 MMP1001 MMP1051 MMP1069 MMP1071 MMP1072 MMP1073 MMP1074 MMP1091 MMP1234 MMP1235 MMP1282 MMP1469 MMP1573 MMP1598 MMP1611 MMP1682 MMP1712 | feoB trxB surE subgroup I ehbC ehbD moaE ehbA bioD recJ | hypothetical protein | L-seryl-tRNA selenium transferase related protein | DNA replication protein; MCM family; putative | CBS domain Related protein | Nitroreductase family | archaeal phosphoglycerate mutase-related | ferrous iron transporter (GTP-binding) | Phosphoribosylaminoimidazole carboxylase related protein | thioredoxin reductase | Survival protein SurE | Basic helix-loop-helix dimerization domain bHLH:Peptidase U7:Signal peptide peptidase, SppA 36 kDa type | Aminotransferase (subgroup I) similar to Aromatic Aminotransferase | putative monovalent cation/H+ antiporter subunit G | ADP-glucose pyrophosphorylase | Molybdopterin biosynthesis MoaE | putative monovalent cation/H+ antiporter subunit E | Dethiobiotin synthetase | single stranded DNA-specific exonuclease | Transcriptional regulator, LysR Family Member |
| 107 | 32 | 39 | -13.380 | 0.432 | 
Residual = 0.432 |  | 
tctAtGGtGG | 
CCCgcgCaGAGCcC |  | MMP0014 MMP0015 MMP0098 MMP0104 MMP0105 MMP0106 MMP0212 MMP0637 MMP0873 MMP0917 MMP0935 MMP0936 MMP1038 MMP1039 MMP1040 MMP1041 MMP1042 MMP1043 MMP1044 MMP1045 MMP1046 MMP1047 MMP1190 MMP1219 MMP1337 MMP1429 MMP1464 MMP1465 MMP1466 Unanno_3 Unanno_5 Unanno_60 | truD dapF aroE atpH atpI atpK atpE atpC atpF atpA atpB atpD rpm ehaQ ehaR ehaS Unanno_1 | tRNA pseudouridine synthase D | hypothetical protein | ferredoxin | polyferredoxin | glycyl-tRNA synthetase | Transcriptional regulator, ArsR family member | TPR repeat | Diaminopimelate epimerase | shikimate 5-dehydrogenase | A1A0 ATPase, subunit H | V-type ATP synthase subunit I | V-type ATP synthase subunit K | A1A0 ATPase, subunit IE | V-type ATP synthase subunit C | V-type ATP synthase subunit F | V-type ATP synthase subunit A | V-type ATP synthase subunit B | V-type ATP synthase subunit D | Peptidylprolyl isomerase, FKBP-type | putative dinG ATP-dependent helicase | hydrogenase maturation protease, related | Transcription factor TFIIS:DNA-directed RNA polymerase, M/15 kDa subunit |
| 108 | 22 | 39 | -14.764 | 0.325 | 
Residual = 0.325 |  | 
gGGGGAt | 
ATATTGCCCtAGGtGGggAAT |  | MMP0029 MMP0042 MMP0194 MMP0335 MMP0542 MMP0628 MMP0634 MMP0635 MMP0711 MMP0964 MMP0988 MMP1015 MMP1156 MMP1162 MMP1385 MMP1486 MMP1660 MMP1703 Unanno_18 Unanno_20 Unanno_25 Unanno_50 | corA fruB | hypothetical protein | H/ACA RNA-protein complex component Gar1 | probable Molybdenum-pterin binding protein | ABC transporter:ATPase subunit | magnesium, nickel and cobalt transport protein | RNA methyltransferase related protein | Transcription factor CBF/NF-Y/archaeal histone:Histone-fold/TFIID-TAF/NF-Y domain | Flavodoxin:Beta-lactamase-like | coenzyme F420-reducing hydrogenase subunit beta | putative mechanosensitive ion channel |
| 109 | 14 | 39 | -18.906 | 0.196 | 
Residual = 0.196 |  | 
GGAGGC | 
GCGAGAaG |  | MMP0033 MMP0092 MMP0246 MMP0247 MMP0248 MMP0566 MMP0568 MMP0603 MMP0604 MMP0694 MMP0707 MMP1114 MMP1115 MMP1361 | rpoF aIF-1A rpe rpoB2 | LysR family member | DNA-directed RNA polymerase subunit F | hypothetical protein | ribosomal biogenesis protein | DNA-directed RNA polymerase related protein | acyl-CoA synthetase | transcriptional regulator related protein | translation initiation factor IF-1A | Beta-lactamase-like:KH domain | Na+/H+ exchanger | Pentose-5-phosphate 3-epimerase | Transketolase, N terminal half | DNA-directed RNA polymerase subunit beta'' |
| 110 | 17 | 39 | -20.593 | 0.219 | 
Residual = 0.219 |  | 
TTTggtaggTActtTAATTtcagt | 
CgCCtCgCG |  | MMP0090 MMP0114 MMP0436 MMP0515 MMP0551 MMP0560 MMP0741 MMP0751 MMP0752 MMP0781 MMP0804 MMP0805 MMP0957 MMP1179 MMP1309 MMP1572 MMP1631 | rimK modB and some other nucleotide dsbD | Glycosyl transferase | hypothetical protein | putative SSU ribosomal protein S6 modification protein | Molybdenum ABC transporter, permease protein | Binding-protein-dependent transport systems inner membrane component | SAM (and some other nucleotide) binding motif:Family of unknown function Met10 | SAM (and some other nucleotide) binding motif:Generic methyltransferase | PA-phosphatase related phosphoesterase |
| 111 | 22 | 39 | -16.023 | 0.303 | 
Residual = 0.303 |  | 
AtGGTG | 
gCATCAATCAAAATcTagcgA |  | MMP0078 MMP0079 MMP0131 MMP0325 MMP0561 MMP0564 MMP0602 MMP0706 MMP0881 MMP0942 MMP0943 MMP1107 MMP1109 MMP1112 MMP1344 MMP1345 MMP1470 MMP1491 MMP1521 MMP1659 MMP1722 Unanno_61 | cmd pyrF taqD Di-trans-poly-cis-decaprenylcistransferase pdfA trzA pyrB hisF | hypothetical protein | orotate phosphoribosyltransferase | Pyridoxal phosphate-dependent amino acid decarboxylase | glyceraldehyde-3-phosphate dehydrogenase | Carboxymuconolactone decarboxylase:Alkylhydroperoxidase AhpD core domain | Orotidine-5'-phosphate decarboxylase | NAD binding site:UDP-glucose/GDP-mannose dehydrogenase | glycerol-3-phosphate cytidyltransferase | Signal recognition particle protein SRP19 | undecaprenyl pyrophospahte synthetase related protein (Di-trans-poly-cis-decaprenylcistransferase) | Prefoldin alpha subunit (GimC alpha subunit). | Chlorohydrolase | aspartate carbamoyltransferase catalytic subunit | Imidazoleglycerol-phosphate synthase, cyclase subunit |
| 112 | 19 | 38 | -18.320 | 0.278 | 
Residual = 0.278 |  | 
TGGTTnCAgaAtCCC | 
AATGggGCGAGAcC |  | MMP0081 MMP0082 MMP0083 MMP0162 MMP0414 MMP0540 MMP0704 MMP0894 MMP1017 MMP1188 MMP1306 MMP1308 MMP1426 MMP1427 MMP1437 MMP1583 MMP1585 MMP1615 MMP1616 | gltB thrS purC guaA lysC tal dcd top6A aspC | glutamate synthase; large subunit; archaeal subunit 2 | glutamate synthase; large subunit; archaeal subunit 3 | hypothetical protein | threonyl-tRNA synthetase | phosphoribosylaminoimidazole-succinocarboxamide synthase | ParA type ATPase | GMP synthase subunit B | aspartate kinase | putative translaldolase | Bifunctional dCTP deaminase/dUTP diphosphatase | DNA topoisomerase VI subunit A | S-adenosylmethionine decarboxylase related | Arginase | aspartyl-tRNA synthetase |
| 113 | 22 | 40 | -15.854 | 0.269 | 
Residual = 0.269 |  | 
nCCaCC | 
TGGGGt |  | Antisense_22 MMP0058 MMP0372 MMP0817 MMP1297 MMP1298 MMP1299 MMP1300 MMP1301 MMP1302 MMP1382 MMP1383 MMP1384 MMP1385 MMP1691 MMP1692 MMP1693 MMP1694 MMP1695 MMP1696 MMP1697 Unanno_63 | mer mtd frcB fdhB fdhA fdhC fruA fruD fruG fruB fwdB vhuB vhuU vhuA vhuG vhuD hdrA | methylenetetrahydromethanopterin reductase | F420-dependent methylenetetrahydromethanopterin dehydrogenase | coenzyme F420-reducing hydrogenase subunit beta | formate dehydrogenase beta subunit | formate dehydrogenase alpha subunit | carbonic anhydrase | hypothetical protein | Formate transporter | coenzyme F420-reducing hydrogenase subunit alpha | coenzyme F420-reducing hydrogenase delta subunit | coenzyme F420-reducing hydrogenase subunit gamma | tungsten containing formylmethanofuran dehydrogenase subunit B | polyferredoxin, associated with F420-non-reducing hydrogenase | F420 non-reducing hydrogenase subunit | F420-non-reducing hydrogenase subunit alpha | F420-non-reducing hydrogenase subunit | F420-non-reducing hydrogenase subunit delta | heterodisulfide reductase, subunit A |
| 114 | 19 | 40 | -21.700 | 0.226 | 
Residual = 0.226 |  | 
gCCCgagGTGGG | 
CGGgGA |  | MMP0058 MMP0372 MMP0817 MMP0822 MMP0824 MMP1378 MMP1382 MMP1383 MMP1384 MMP1691 MMP1692 MMP1693 MMP1694 MMP1695 MMP1696 MMP1697 Unanno_20 Unanno_25 Unanno_63 | mer mtd frcB vhcG vhcB fruA fruD fruG fwdB vhuB vhuU vhuA vhuG vhuD hdrA | methylenetetrahydromethanopterin reductase | F420-dependent methylenetetrahydromethanopterin dehydrogenase | coenzyme F420-reducing hydrogenase subunit beta | coenzyme F420-non-reducing hydrogenase subunit gamma | coenzyme F420-non-reducing hydrogenase subunit beta | hypothetical protein | coenzyme F420-reducing hydrogenase subunit alpha | coenzyme F420-reducing hydrogenase delta subunit | coenzyme F420-reducing hydrogenase subunit gamma | tungsten containing formylmethanofuran dehydrogenase subunit B | polyferredoxin, associated with F420-non-reducing hydrogenase | F420 non-reducing hydrogenase subunit | F420-non-reducing hydrogenase subunit alpha | F420-non-reducing hydrogenase subunit | F420-non-reducing hydrogenase subunit delta | heterodisulfide reductase, subunit A |
| 115 | 29 | 37 | -10.838 | 0.489 | 
Residual = 0.489 |  | 
TTnAaaagGGgnAAc | 
ACAATACtGC |  | MMP0038 MMP0039 MMP0040 MMP0118 MMP0165 MMP0233 MMP0403 MMP0579 MMP0580 MMP0607 MMP0632 MMP0666 MMP0689 MMP0865 MMP0883 MMP0918 MMP0942 MMP0948 MMP0969 MMP1069 MMP1186 MMP1279 MMP1290 MMP1317 MMP1430 MMP1471 MMP1704 MMP1711 MMP1722 | act nrpR P-loop subgroup II asnB lon K+ pcnA hisF | hypothetical protein | type II secretion system protein; putative; subunit 1 | ABC transporter, family 2 | Radical-activating enzyme | Transcriptional repressor of nif and glnA operons | ATP/GTP-binding site motif A (P-loop) | Na+/Pi-cotransporter related protein | Xanthine/uracil permease family | Aminotransferase (subgroup II) similar to Adenosylmethionine-8-amino-7-oxononanoate aminotransferase | Asparagine synthetase (glutamine-hydrolyzing) | Basic helix-loop-helix dimerization domain bHLH:Peptidase U7:Signal peptide peptidase, SppA 36 kDa type | Eukaryotic thiol (cysteine) protease, active site:ATP/GTP-binding site motif A (P-loop):Sigma-54 factor interaction domain:Pu... | Camphor resistance CrcB protein | GTP-binding protein | putative TRK system cation (K+) uptake protein | Proliferating cell nuclear antigen, PCNA | Imidazoleglycerol-phosphate synthase, cyclase subunit |
| 116 | 8 | 37 | -26.800 | 0.073 | 
Residual = 0.073 |  | 
| 
|  | MMP1407 MMP1408 MMP1409 MMP1410 MMP1411 MMP1412 MMP1413 MMP1414 | rps17p rpl14p rpl24p rpl5p rps14P rps8p | ribonuclease P protein component 1 | 30S ribosomal protein S17P | 50S ribosomal protein L14P | 50S ribosomal protein L24P | 30S ribosomal protein S4e | 50S ribosomal protein L5P | 30S ribosomal protein S14P | 30S ribosomal protein S8P |
| 117 | 29 | 37 | -17.626 | 0.420 | 
Residual = 0.420 |  | 
TTTcTTctaGaaTATccCGGGtGA | 
TTTTCcAgatTTtg |  | Antisense_23 MMP0030 MMP0052 MMP0177 MMP0225 MMP0226 MMP0289 MMP0439 MMP0788 MMP0849 MMP0992 MMP1088 MMP1118 MMP1235 MMP1236 MMP1241 MMP1330 MMP1447 MMP1452 MMP1453 MMP1454 MMP1456 MMP1459 MMP1461 MMP1619 MMP1662 MMP1665 MMP1679 Unanno_49 | gldA hypD pyrD moaE HUPF/HYPC ehaE ehaF ehaG ehaI ehaL ehaN cbiF | DNA replication protein; MCM family; putative | hypothetical protein | glycerol dehydrogenase | Hydrogenase expression/formation protein | dihydroorotate dehydrogenase 1B | L-lysine/ homoserine-homoserine lactone exporter family | Glycosyl transferase, group 1 | Molybdopterin biosynthesis MoaE | Hydrogenase expression/formation protein (HUPF/HYPC) | Cro repressor family Helix-turn-helix motif containing protein | energy conserving hydrogenase A small subunit | Molybdenum cofactor biosynthesis protein:MoeA N-terminal region, domain I and II:MoeA C-terminal, domain IV | Precorrin-4 C11-methyltransferase |
| 118 | 8 | 38 | -25.060 | 0.096 | 
Residual = 0.096 |  | 
| 
|  | MMP1319 MMP1320 MMP1321 MMP1322 MMP1323 MMP1324 MMP1325 MMP1326 | rps13p rps4p rps11p rpoD rpl13p rps9p rpoN | 30S ribosomal protein S13P | 30S ribosomal protein S4 | 30S ribosomal protein S11P | DNA-directed RNA polymerase, subunit D | 50S ribosomal protein L18e | 50S ribosomal protein L13P | 30S ribosomal protein S9P | DNA-directed RNA polymerase subunit N |
| 119 | 21 | 39 | -21.876 | 0.251 | 
Residual = 0.251 |  | 
TCCaTtaaTTtCagC | 
CgggtgaAnAntgtcCaAaAaAAC |  | Antisense_11 Antisense_12 Antisense_14 Antisense_15 Antisense_19 Antisense_20 Antisense_21 Antisense_25 Antisense_26 Antisense_7 MMP0339 MMP0439 MMP0821 MMP0940 MMP1056 MMP1478 MMP1528 MMP1568 MMP1569 Unanno_46 Unanno_53 | Antisense_1 pyrD vhcD cbiA pheA | NUDIX hydrolase | dihydroorotate dehydrogenase 1B | coenzyme F420-non-reducing hydrogenase subunit delta | related to ehbP of Methanothermobacter thermautotrophicus | hypothetical protein | Cobyrinic acid a,c-diamide synthase:Cobyrinic acid a,c-diamide synthase CbiA | prephenate dehydratase |
| 120 | 18 | 40 | -17.495 | 0.262 | 
Residual = 0.262 |  | 
GCGAaGG | 
CGtCAGC |  | MMP0013 MMP0073 MMP0133 MMP0223 MMP0340 MMP0341 MMP0955 MMP1101 MMP1113 MMP1114 MMP1115 MMP1222 MMP1253 MMP1254 MMP1255 MMP1314 MMP1316 MMP1532 | argH argG guaB pycB pycA sucD subgroup II rpe radA purM pheT korB pgk | argininosuccinate lyase | argininosuccinate synthase | IMP dehydrogenase | hypothetical protein | pyruvate carboxylase subunit B | pyruvate carboxylase subunit A | succinyl-CoA synthetase subunit alpha | Aminotransferase (subgroup II) similar to Acetylornithine aminotransferase | transketoloase, C terminal half | Pentose-5-phosphate 3-epimerase | Transketolase, N terminal half | DNA repair and recombination protein RadA | phosphoribosylaminoimidazole synthetase | phenylalanyl-tRNA synthetase subunit beta | Phosphoesterase, RecJ-like:RNA binding S1:OB-fold nucleic acid binding domain Related protein | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | phosphoglycerate kinase |
| 121 | 20 | 39 | -19.103 | 0.238 | 
Residual = 0.238 |  | 
gtttGgTGgTcATatGGcAAaTC | 
CCAGGGTCTTTGAGC |  | MMP0001 MMP0002 MMP0054 MMP0055 MMP0630 MMP0631 MMP0684 MMP0686 MMP0787 MMP0885 MMP1002 MMP1003 MMP1004 MMP1005 MMP1006 MMP1007 MMP1008 MMP1599 Unanno_36 Unanno_55 | feoB hsp20 P-loop trpA trpB trpF trpG trpE trpD trpC trkA | hypothetical protein | L-seryl-tRNA selenium transferase related protein | ferrous iron transporter (GTP-binding) | putatuve iron dependent repressor | Heat shock protein Hsp20 | fructose-bisphosphate aldolase | Transcriptional regulator, MarR Family Member | TPR repeat:ATP/GTP-binding site motif A (P-loop) | tryptophan synthase subunit alpha | tryptophan synthase subunit beta | N-(5'-phosphoribosyl)anthranilate isomerase | anthranilate synthase component II | anthranilate synthase component I | Anthranilate phosphoribosyltransferase | indole-3-glycerol-phosphate synthase | Trk system potassium uptake protein A |
| 122 | 14 | 37 | -20.433 | 0.229 | 
Residual = 0.229 |  | 
AATGgCGGTG | 
cGgAAATtCcG |  | MMP0131 MMP0185 MMP0222 MMP0291 MMP0329 MMP0330 MMP0910 MMP0938 MMP1086 MMP1132 MMP1133 MMP1491 MMP1521 MMP1659 | mtaP cbiC cobS endA comC trzA pyrB | Pyridoxal phosphate-dependent amino acid decarboxylase | 5'-methylthioadenosine phosphorylase | hypothetical protein | hydrogenase expression/formation protein related | precorrin-8X methylmutase | cobalamin (5'-phosphate) synthase | tRNA-splicing endonuclease subunit alpha | L-sulfolactate dehydrogenase/(S)-hydroxyglutaric acid dehydrogenase | Chlorohydrolase | aspartate carbamoyltransferase catalytic subunit |
| 123 | 33 | 38 | -9.303 | 0.431 | 
Residual = 0.431 |  | 
TGaGacACatCgGcnG | 
TtGAaTTTaAAAC |  | MMP0020 MMP0123 MMP0624 MMP0628 MMP0683 MMP0763 MMP0772 MMP0820 MMP0825 MMP0908 MMP1016 MMP1067 MMP1134 MMP1135 MMP1136 MMP1154 MMP1156 MMP1158 MMP1223 MMP1229 MMP1251 MMP1252 MMP1347 MMP1439 MMP1533 MMP1534 MMP1642 MMP1660 MMP1661 MMP1685 MMP1697 Unanno_32 Unanno_38 | purT ftsY frcA hdrA hdrC1 HMmB P-loop | nickel responsive regulator | phosphoribosylglycinamide formyltransferase 2 | hypothetical protein | probable Molybdenum-pterin binding protein | signal recognition particle receptor SRalpha | coenzyme F420-reducing hydrogenase subunit alpha | heterodisulfide reductase subunit A | CBS domain | succinate dehydrogenase/fumarate reductase iron-sulfur subunit | type A flavoprotein | Flavodoxin:Beta-lactamase-like | Rubrerythrin | heterosulfide reductase, subunit C1 | archaeal histone B | cofactor-independent phosphoglycerate mutase | ATP/GTP-binding site motif A (P-loop):Small GTP-binding protein domain | heterodisulfide reductase, subunit A |
| 124 | 22 | 41 | -9.304 | 0.423 | 
Residual = 0.423 |  | 
GGGGgGAT | 
gAGcaTaTGGG |  | MMP0148 MMP0253 MMP0347 MMP0348 MMP0546 MMP0562 MMP0563 MMP0613 MMP0977 MMP0978 MMP0979 MMP0980 MMP0981 MMP0982 MMP0983 MMP1100 MMP1258 MMP1468 MMP1633 MMP1634 Unanno_56 Unanno_57 | acsA acd CooC cdh cdhD cdhB hemB | acetyl-CoA synthetase, AMP-forming | acetyl-CoA synthetase (ADP-forming), alpha and beta subunits | hypothetical protein | Alpha-acetolactate decarboxylase | CO dehydrogenase maturation factor | acetyl-CoA decarbonylase/synthase complex subunit gamma | acetyl-CoA decarbonylase/synthase complex subunit delta | acetyl-CoA decarbonylase/synthase complex subunit beta | putative transcriptional regulator | delta-aminolevulinic acid dehydratase |
| 125 | 15 | 38 | -24.149 | 0.240 | 
Residual = 0.240 |  | 
GgGGGGAT | 
TACGCAtATAACtAtGccTgTATG |  | MMP0292 MMP0293 MMP0294 MMP0434 MMP0614 MMP0720 MMP0721 MMP0852 MMP0996 MMP0997 MMP1164 MMP1165 MMP1174 MMP1633 MMP1634 | type 1 | hypothetical protein | aldolase | Bacterial quinoprotein | related to iron-sulfur flavoprotein of Methanosarcina thermophila | hydroxylamine reductase | ferredoxin | Blue (type 1) copper domain | heavy-metal transport ATPase related protein | Haloacid dehalogenase/epoxide hydrolase:ATPase, E1-E2 type:Heavy metal transport/detoxification protein | peroxiredoxin |
| 126 | 33 | 39 | -14.279 | 0.413 | 
Residual = 0.413 |  | 
AgcAcACaTCaAAtATATagaTAc | 
TAATATAcTAATaaAAAcCTA |  | MMP0219 MMP0333 MMP0383 MMP0386 MMP0503 MMP0591 MMP0592 MMP0593 MMP0795 MMP0934 MMP0935 MMP1191 MMP1195 MMP1304 MMP1305 MMP1518 MMP1519 MMP1520 MMP1560 MMP1561 MMP1562 MMP1563 MMP1564 MMP1565 MMP1566 MMP1567 MMP1644 MMP1645 MMP1717 MMP1718 Unanno_17 Unanno_3 Unanno_51 | ppaC slp HMmA mch yneG P-loop mtrE mtrD mtrC mtrB mtrA or900 mtrG mtrH Unanno_1 | putative manganese-dependent inorganic pyrophosphatase | hypothetical protein | S-layer protein | archaeal histone A | walker type ATPase | N(5),N(10)-methenyltetrahydromethanopterin cyclohydrolase | putative cytoplasmic protein | Response regulator receiver | sulfate/molybdate ABC-transporter homolog, ATPase subunit | anion transport system permease protein | ATP/GTP-binding site motif A (P-loop):HypB/UreG, nucleotide-binding:Hydrogenase accessory protein HypB | tetrahydromethanopterin S-methyltransferase subunit E | tetrahydromethanopterin S-methyltransferase subunit D | tetrahydromethanopterin S-methyltransferase subunit C | tetrahydromethanopterin S-methyltransferase subunit B | tetrahydromethanopterin S-methyltransferase subunit A | tetrahydromethanopterin S-methyltransferase subunit G | tetrahydromethanopterin S-methyltransferase subunit H | amino acid kinase related protein | possible methyltransferase related protein |
| 127 | 12 | 40 | -23.095 | 0.142 | 
Residual = 0.142 |  | 
cCCGTgA | 
GTtGacGGT |  | MMP0197 MMP0484 MMP0495 MMP0741 MMP0751 MMP0766 MMP0774 MMP0781 MMP0782 MMP0973 MMP1571 MMP1572 | III resP | ABC-type iron(III) transport system, permease component | possible sodium/proton antiporter | hypothetical protein | Site-specific recombinase |
| 128 | 8 | 38 | -31.306 | 0.098 | 
Residual = 0.098 |  | 
GACGGG | 
cGctgGgc |  | MMP0062 MMP0298 MMP1207 MMP1543 MMP1544 MMP1545 MMP1546 MMP1547 | rpl15 rpl3p rpl4lp rplW rpl2p rps19p | 50S ribosomal protein L31e | 50S ribosomal protein L15e | 30S ribosomal protein S6e | 50S ribosomal protein L3P | 50S ribosomal protein L4P | 50S ribosomal protein L23 | 50S ribosomal protein L2P | 30S ribosomal protein S19P |
| 129 | 26 | 35 | -14.976 | 0.318 | 
Residual = 0.318 |  | 
tccGCCAC | 
CCtgACtGTGC |  | Antisense_13 MMP0036 MMP0072 MMP0131 MMP0264 MMP0265 MMP0296 MMP0554 MMP0580 MMP0876 MMP0883 MMP0906 MMP0941 MMP0970 MMP1011 MMP1109 MMP1112 MMP1121 MMP1265 MMP1334 MMP1356 MMP1440 MMP1467 MMP1600 MMP1630 Unanno_61 | tfe MscMJ and some other nucleotide act cofG lig gltX Gln P-loop ehaT glutaminyl transferase | transcription initiation factor E subunit alpha | hypothetical protein | Pyridoxal phosphate-dependent amino acid decarboxylase | Mechanosensitive (MS) ion channel | SAM (and some other nucleotide) binding motif | Radical-activating enzyme | FO synthase subunit 1 | ATP-dependent DNA ligase | glutamyl-tRNA synthetase | metal-dependent phophohydrolase related protein | glutamyl-tRNA(Gln) amidotransferase subunit E | Solute-binding protein/glutamate receptor:ATP/GTP-binding site motif A (P-loop):GTP-binding protein, HSR1-related:GTP-binding... | Ribosomal protein S6 modification enzyme (glutaminyl transferase) related | ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase |
| 130 | 14 | 39 | -27.385 | 0.233 | 
Residual = 0.233 |  | 
GgCCtCcATcTG | 
TAaTAtATAcgAaTTttCA |  | MMP0034 MMP0223 MMP0224 MMP0639 MMP0640 MMP0641 MMP0952 MMP1362 MMP1363 MMP1364 MMP1370 MMP1371 MMP1432 MMP1658 | hemL rps28e rpl7ae aIF-5A rpoB1 rpoA1 rpoA2 aEF-1_alpha rps10p purA | hypothetical protein | glutamate-1-semialdehyde aminotransferase | LSU ribosomal protein L23E | 30S ribosomal protein S28e | 50S ribosomal protein L7Ae | translation initiation factor IF-5A | DNA-directed RNA polymerase subunit B' | DNA-directed RNA polymerase subunit alpha | DNA-directed RNA polymerase subunit A'' | elongation factor 1-alpha | 30S ribosomal protein S10P | adenylosuccinate synthetase | 30S ribosomal protein S8e |
| 131 | 25 | 38 | -14.195 | 0.334 | 
Residual = 0.334 |  | 
acgGngGgGAt | 
CCACCtGAA |  | MMP0029 MMP0174 MMP0194 MMP0200 MMP0423 MMP0461 MMP0462 MMP0463 MMP0474 MMP0484 MMP0652 MMP0739 MMP0818 MMP0819 MMP0820 MMP0837 MMP0847 MMP0988 MMP0998 MMP1225 MMP1486 MMP1529 MMP1660 MMP1661 MMP1685 | fmdE frcG frcD frcA | hypothetical protein | HD phosphohydrolase family member | molybdenum containing formylmethanofuran dehydrogenase, subunit E | possible sodium/proton antiporter | Asp/Glu racemase:Aspartate racemase | coenzyme F420-reducing hydrogenase subunit gamma | coenzyme F420-reducing hydrogenase subunit delta | coenzyme F420-reducing hydrogenase subunit alpha | RNase HI related protein | RNA methyltransferase related protein | amino acid ABC-type transporter related protein | putative mechanosensitive ion channel |
| 132 | 8 | 38 | -65.710 | 0.075 | 
Residual = 0.075 |  | 
CcgaGTgaTacgGaCcgAGGaCCg | 
GcgaaGGTCgagcaTAAGCctccg |  | RNA_36 RNA_37 RNA_38 RNA_39 RNA_40 RNA_41 RNA_42 RNA_44 | tRNA-Ala2 rrnD5S rrnA23S rrnA16S rrnB23S rrnB16S rrnC23S rrnC16S | tRNA-Ala | 5S ribosomal RNA | 23S ribosomal RNA | 16S ribosomal RNA |
| 133 | 26 | 38 | -12.059 | 0.372 | 
Residual = 0.372 |  | 
GAGGgG | 
GTCtCcAAc |  | MMP0118 MMP0170 MMP0186 MMP0844 MMP0930 MMP1066 MMP1090 MMP1199 MMP1230 MMP1231 MMP1454 MMP1455 MMP1456 MMP1457 MMP1458 MMP1459 MMP1460 MMP1461 MMP1462 MMP1463 MMP1464 MMP1465 MMP1466 MMP1467 MMP1630 Unanno_59 | cofF cheR ehaG ehaH ehaI ehaJ ehaK ehaL ehaM ehaN ehaO ehaP ehaQ ehaR ehaS ehaT P-loop | hypothetical protein | gamma-F420-2:alpha-L-glutamate ligase | chemotaxis protein CheR | putative molybdenum cofactor biosynthesis protein C | UDP-glucose 4-epimerase related | phosphate transport system regulatory protein-related | DNA polymerase, beta-like region | putative HAD family hydrolase, a fragment | putative transmembrane subunit of a hydrogenase | energy conserving hydrogenase A integral membrane subunit | energy conserving hydrogenase A small subunit | energy conserving hydrogenase A large subunit | polyferredoxin | ATP/GTP-binding site motif A (P-loop):ABC transporter:AAA ATPase |
| 134 | 7 | 37 | -30.359 | 0.059 | 
Residual = 0.059 |  | 
| 
|  | MMP1415 MMP1416 MMP1417 MMP1418 MMP1419 MMP1420 MMP1421 | rpl6p rpl32e rpl19e rpl18p rps5p rpl30p rpl15p | 50S ribosomal protein L6P | 50S ribosomal protein L32e | 50S ribosomal protein L19e | 50S ribosomal protein L18P | 30S ribosomal protein S5P | 50S ribosomal protein L30P | 50S ribosomal protein L15P |
| 135 | 16 | 40 | -17.488 | 0.225 | 
Residual = 0.225 |  | 
GGAGGT | 
GAGGgctTgcc |  | MMP1038 MMP1039 MMP1040 MMP1041 MMP1042 MMP1043 MMP1044 MMP1045 MMP1046 MMP1047 MMP1370 MMP1435 MMP1436 MMP1523 MMP1524 Unanno_1 | atpH atpI atpK atpE atpC atpF atpA atpB atpD aEF-1_alpha secE ftsZ1 secD secF | A1A0 ATPase, subunit H | V-type ATP synthase subunit I | V-type ATP synthase subunit K | A1A0 ATPase, subunit IE | V-type ATP synthase subunit C | V-type ATP synthase subunit F | V-type ATP synthase subunit A | V-type ATP synthase subunit B | V-type ATP synthase subunit D | hypothetical protein | elongation factor 1-alpha | preprotein translocase subunit SecE | cell division protein FtsZ | preprotein translocase subunit SecD | preprotein translocase subunit SecF |
| 136 | 27 | 35 | -11.068 | 0.410 | 
Residual = 0.410 |  | 
tagtAaaGTtnCCgC | 
GAGGCgCG |  | MMP0075 MMP0087 MMP0088 MMP0164 MMP0429 MMP0644 MMP0645 MMP0646 MMP0874 MMP0875 MMP0887 MMP0888 MMP0889 MMP0917 MMP0965 MMP1035 MMP1036 MMP1175 MMP1176 MMP1177 MMP1178 MMP1181 MMP1182 MMP1183 MMP1646 MMP1699 Unanno_9 | hmgA hemA cbiX(s) mdh and some other nucleotide slpB dapF III Unanno_1 | hypothetical protein | Hydroxymethylglutaryl-coenzyme A reductase:3-hydroxy-3-methylglutaryl Coenzyme A reductase | glutamyl-tRNA reductase | sirohydrochlorin cobaltochelatase | Beta-Ig-H3/Fasciclin domain:hypothetical protein | Cation efflux protein | malate dehydrogenase | SAM (and some other nucleotide) binding motif | S layer protein | cobalt transport protein CbiN | cobalt transport protein CbiM | Diaminopimelate epimerase | formylmethanofuran dehydrogenase subunit E related protein | Band 7 protein:Stomatin | putative iron transport system substrate-binding protein, N-term half | putative iron transport system substrate-binding protein, C-term half | iron transport Periplasmic binding protein | iron transport system binding protein | Iron(III) dicitrate transport system permease protein | iron ABC transporter ATPase subunit |
| 137 | 21 | 37 | -22.345 | 0.246 | 
Residual = 0.246 |  | 
GTTCGATtgngnnTCTngnctC | 
AAACaATGgTTTATTATacG |  | MMP0145 MMP0146 MMP0187 MMP0404 MMP0417 MMP0418 MMP0606 MMP0607 MMP0881 MMP1081 MMP1083 MMP1105 MMP1106 MMP1122 MMP1146 MMP1206 MMP1316 MMP1440 MMP1496 MMP1532 MMP1656 | hpt thiC cofD hisA nrpR wbpG sucC purF glnA korB pheS pgk | adenine phosphoribosyltransferase | hypothetical protein | thiamine biosynthesis protein ThiC | LPPG:FO 2-phospho-(S)-lactate transferase | 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)me thylideneamino)imidazole-4-carboxamide isomerase | Carbohydrate kinase, PfkB | similar to 23S ribosomal RNA methyltransferase | Transcriptional repressor of nif and glnA operons | putative LPS biosynthesis protein WbpG | imidazole glycerol phosphate synthase subunit HisF | succinate-CoA ligase (ADP-forming), beta chain | translation-associated GTPase | Amidophosphoribosyltransferase | glutamine synthetase | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | phenylalanyl-tRNA synthetase subunit alpha | phosphoglycerate kinase | putative pyridoxine biosynthetic glutamine amidotransferase |
| 138 | 14 | 40 | -20.445 | 0.216 | 
Residual = 0.216 |  | 
cGaGGaGa | 
GGCTcATC |  | MMP0060 MMP0061 MMP0062 MMP0150 MMP0151 MMP0245 MMP0574 MMP0575 MMP0576 MMP0577 MMP0578 MMP1147 MMP1579 Unanno_19 | aIF6 rpl40e pfdB gatC dapA rps17E aroQ rpl37e rps15p | Ribosomal LX protein | translation initiation factor IF-6 | 50S ribosomal protein L31e | hypothetical protein | 50S ribosomal protein L40e | Prefoldin beta subunit (GimC beta subunit). | aspartyl/glutamyl-tRNA amidotransferase subunit C | dihydrodipicolinate synthase | 30S ribosomal protein S17e | chorismate mutase | 50S ribosomal protein L37e | 30S ribosomal protein S15P |
| 139 | 21 | 38 | -14.530 | 0.332 | 
Residual = 0.332 |  | 
TnaGGtGatTT | 
TGtgCtTtTTgaangCaanCAAc |  | MMP0056 MMP0152 MMP0353 MMP0356 MMP0357 MMP0358 MMP0541 MMP0579 MMP0989 MMP1077 MMP1117 MMP1189 MMP1327 MMP1328 MMP1356 MMP1499 MMP1500 MMP1554 MMP1610 MMP1648 MMP1711 | cofH serB top6B rpoK ftsz2 pcnA | FO synthase subunit 2 | Cation transporter | UDP-glucose/GDP-mannose dehydrogenase Related protein | Glycosyl transferase, group 1 | UDP-N-acetylglucosamine 2-epimerase | hypothetical protein | Phosphoserine phosphatase | DNA topoisomerase VI subunit B | Phosphoglucomutase/phosphomannomutase:Calcium- bin ding EF-hand | Ribose 5-phosphate isomerase | DNA-directed RNA polymerase, subunit K | Enolase | cell division protein FtsZ | Proliferating cell nuclear antigen, PCNA |
| 140 | 36 | 37 | -12.487 | 0.374 | 
Residual = 0.374 |  | 
aTCTGGTG | 
GGGTTCAAATCCCgccCagaGCGC |  | MMP0046 MMP0074 MMP0106 MMP0133 MMP0210 MMP0220 MMP0224 MMP0282 MMP0319 MMP0346 MMP0356 MMP0530 MMP0531 MMP0541 MMP0550 MMP0554 MMP0588 MMP0609 MMP0705 MMP0707 MMP0865 MMP0878 MMP0880 MMP0999 MMP1068 MMP1106 MMP1312 MMP1326 MMP1353 MMP1356 MMP1357 MMP1362 MMP1425 MMP1426 MMP1438 MMP1540 | guaB hemL purE cbiL Component D serB and some other nucleotide dph5 pth2 wbpI subgroup II aksF rpoN rpoB1 dcd | hypothetical protein | IMP dehydrogenase | Sodium/proline symporter-related | glutamate-1-semialdehyde aminotransferase | phosphoribosylaminoimidazole carboxylase catalytic subunit | precorrin-2 C-20 methyltransferase | 2-hydroxyglutaryl-CoA dehydratase (Component D) related protein | Glycosyl transferase, group 1 | Phosphoserine phosphatase | similar to ABC-type amino acid transport system, periplasmic component | SAM (and some other nucleotide) binding motif | diphthine synthase | peptidyl-tRNA hydrolase | UDP-N-acetylglucosamine 2-epimerase | Na+/H+ exchanger | Aminotransferase (subgroup II) similar to Adenosylmethionine-8-amino-7-oxononanoate aminotransferase | Ribonuclease P-related protein | 2-oxosuberate synthase, last step | K+-dependent Na+/Ca+ exchanger related-protein:Sodium/calcium exchanger membrane region | DNA-directed RNA polymerase subunit N | ThiamineS | DNA-directed RNA polymerase subunit B' | tRNA 2'-O-methylase | Bifunctional dCTP deaminase/dUTP diphosphatase |
| 141 | 16 | 38 | -23.880 | 0.288 | 
Residual = 0.288 |  | 
ATCtCtATTCTtTAcATTCC | 
GCAAATCATATTTGGTTTCATAC |  | MMP0137 MMP0319 MMP0320 MMP0340 MMP0919 MMP0920 MMP0921 MMP0989 MMP1014 MMP1085 MMP1086 MMP1107 MMP1108 MMP1112 MMP1313 MMP1614 | dys cbiL archaeal pycB ahcY top6B corA fen-1 hisS | putative deoxyhypusine synthase | precorrin-2 C-20 methyltransferase | shikimate kinase (archaeal) | pyruvate carboxylase subunit B | dihydroorotate dehydrogenase electron transfer subunit | S-adenosyl-L-homocysteine hydrolase | hypothetical protein | DNA topoisomerase VI subunit B | Signal recognition particle protein SRP19 | magnesium, nickel and cobalt transport protein | flap endonuclease-1 | histidyl-tRNA synthetase |
| 142 | 25 | 38 | -16.309 | 0.287 | 
Residual = 0.287 |  | 
cCgCcgtgAAC | 
CcACCATTGttaGc |  | MMP0008 MMP0017 MMP0019 MMP0021 MMP0113 MMP0119 MMP0120 MMP0225 MMP0324 MMP0544 MMP0545 MMP0727 MMP0728 MMP0986 MMP1009 MMP1062 MMP1080 MMP1141 MMP1228 MMP1236 MMP1264 MMP1346 MMP1398 MMP1485 MMP1597 | DP1 birA gldA uvrB uvrC thyA pyrC dapE moaB | DNA polymerase II small subunit | hypothetical protein | Biotin--protein ligase | glycerol dehydrogenase | MoaA/nifB/pqqE family | Molybdenum cofactor biosynthesis protein:MoeA N-terminal region, domain I and II:MoeA C-terminal, domain IV | excinuclease ABC subunit B | excinuclease ABC subunit C | thymidylate synthase | Dihydroorotase | Glycosyl transferase, group 1 | Lhr-like RNA helicase | Basic helix-loop-helix dimerization domain bHLH | succinyl-diaminopimelate desuccinylase | Molybdenum cofactor biosynthesis protein |
| 143 | 28 | 40 | -15.609 | 0.298 | 
Residual = 0.298 |  | 
GAGgGCCC | 
CCcAtCAaTTcagcgATaT |  | MMP0007 MMP0145 MMP0153 MMP0178 MMP0179 MMP0187 MMP0264 MMP0418 MMP0540 MMP0606 MMP0607 MMP0697 MMP0698 MMP0879 MMP0880 MMP1063 MMP1081 MMP1082 MMP1083 MMP1085 MMP1122 MMP1146 MMP1198 MMP1496 MMP1592 MMP1594 MMP1681 Unanno_24 | hpt aksA purQ purL thiC MscMJ purC nrpR leuS serS aksF leuA wbpG hisH purF pheS trpS | geranylgeranylglyceryl phosphate synthase-like protein | adenine phosphoribosyltransferase | trans-homoaconitate synthase | Phosphoribosylformylglycinamidine synthase I | Phosphoribosylformylglycinamidine synthase II | thiamine biosynthesis protein ThiC | Mechanosensitive (MS) ion channel | Carbohydrate kinase, PfkB | phosphoribosylaminoimidazole-succinocarboxamide synthase | similar to 23S ribosomal RNA methyltransferase | Transcriptional repressor of nif and glnA operons | leucyl-tRNA synthetase | hypothetical protein | seryl-tRNA synthetase | 2-oxosuberate synthase, last step | 2-isopropylmalate synthase | putative LPS biosynthesis protein WbpG | imidazole glycerol phosphate synthase subunit HisH | imidazole glycerol phosphate synthase subunit HisF | translation-associated GTPase | Amidophosphoribosyltransferase | nitrate/sulfonate/bicarbonate ABC transporter ATPase subunit | phenylalanyl-tRNA synthetase subunit alpha | tryptophanyl-tRNA synthetase |
| 144 | 19 | 41 | -17.419 | 0.267 | 
Residual = 0.267 |  | 
ACCGGAAT | 
cAGGTgcGATGTAAGcCTaC |  | MMP0001 MMP0193 MMP0206 MMP0499 MMP0504 MMP0505 MMP0506 MMP0507 MMP0631 MMP0674 MMP0675 MMP0685 MMP0717 MMP0993 MMP0994 MMP0995 MMP1062 MMP1578 MMP1597 | modB modC modA and some other nucleotide | hypothetical protein | molybdenum ABC transporter, permease protein | Molybdenum transport ATP-binding protein modC | molybdenum transport system permease protein, modB RELATED | molybdate-binding periplasmic protein; permease RELATED | putatuve iron dependent repressor | Helix-turn-helix DNA binding protein | SAM (and some other nucleotide) binding motif:N-6 Adenine-specific DNA methylase | Cytidylyltransferase:Cytidyltransferase-related domain |
| 145 | 18 | 39 | -23.326 | 0.239 | 
Residual = 0.239 |  | 
TattTtATtagatAtAaataGGgG | 
GGGcGg |  | MMP0117 MMP0231 MMP0431 MMP0432 MMP0433 MMP0548 MMP0549 MMP0642 MMP0676 MMP0677 MMP0755 MMP1145 MMP1233 MMP1250 MMP1251 MMP1252 MMP1548 MMP1580 | hisB P-loop minD | hypothetical protein | Rhodopsin-like GPCR superfamily:Beta-lactamase-like | putative flavodoxin | Imidazoleglycerol-phosphate dehydratase | Intermediate filament protein:ATP/GTP-binding site motif A (P-loop):AAA ATPase | ATP/GTP-binding site motif A (P-loop) | Septum formation inhibitor-activating ATPase | TonB-dependent receptor protein:Formate dehydrogenase, subunit FdhD | 6-pyruvoyl tetrahydropterin synthase | CBS domain | Fe-S type hydro-lyase tartrate/fumarate beta region | Dihydropteroate synthase, DHPS:Dihydropteroate synthase-related protein synthase-related protein |
| 146 | 26 | 40 | -11.503 | 0.418 | 
Residual = 0.418 |  | 
CTCCCCct | 
GGtAcgagCTTTnAcnaG |  | Mma-sR04 MMP0122 MMP0128 MMP0447 MMP0455 MMP0499 MMP0514 MMP0520 MMP0522 MMP0523 MMP0524 MMP0525 MMP0648 MMP0757 MMP0775 MMP0785 MMP0813 MMP0835 MMP0863 MMP0864 MMP1110 MMP1124 MMP1243 MMP1605 MMP1664 Unanno_10 | modA rtcA dop napA-2 | hypothetical protein | nitrogenase related protein | Probable amino-acid ABC transporter | Molybdenum ABC transporter, periplasmic molybdenum-binding protein | cation transport ATPase | ABC transporter ATP-binding protein | RNA 3'-terminal-phosphate cyclase | Chymotrypsin serine protease, family S1 | CBS domain | Na+/H+ exchanger | AIR synthase related protein | Pyruvate kinase |
| 147 | 14 | 39 | -23.404 | 0.185 | 
Residual = 0.185 |  | 
CTAACGGTGg | 
GAAGcA |  | MMP1152 MMP1153 MMP1272 MMP1273 MMP1275 MMP1621 MMP1622 MMP1623 MMP1624 MMP1625 MMP1626 MMP1627 MMP1628 MMP1629 | ehbN vorB vorC ehbO ehbM ehbL ehbK ehbJ ehbG ehbF ehbE | hypothetical protein | energy conserving hydrogenase B large subunit | 2-ketoisovalerate ferredoxin reductase | 2-oxoisovalerate oxidoreductase subunit gamma | energy conserving hydrogenase B integral membrane subunit | energy conserving hydrogenase B small subunit | ferredoxin | polyferredoxin | putative monovalent cation/H+ antiporter subunit B | hydrogenase subunit F | putative monovalent cation/H+ antiporter subunit C |
| 148 | 8 | 37 | -31.130 | 0.057 | 
Residual = 0.057 |  | 
| 
|  | MMP1414 MMP1415 MMP1416 MMP1417 MMP1418 MMP1419 MMP1420 MMP1421 | rps8p rpl6p rpl32e rpl19e rpl18p rps5p rpl30p rpl15p | 30S ribosomal protein S8P | 50S ribosomal protein L6P | 50S ribosomal protein L32e | 50S ribosomal protein L19e | 50S ribosomal protein L18P | 30S ribosomal protein S5P | 50S ribosomal protein L30P | 50S ribosomal protein L15P |
| 149 | 26 | 39 | -17.201 | 0.305 | 
Residual = 0.305 |  | 
TATTaancGGtGGt | 
tCTgTccgtCTgGgagGcat |  | MMP0034 MMP0137 MMP0284 MMP0319 MMP0340 MMP0415 MMP0564 MMP0694 MMP0905 MMP0906 MMP0907 MMP0941 MMP0953 MMP1085 MMP1108 MMP1112 MMP1307 MMP1327 MMP1328 MMP1356 MMP1357 MMP1361 MMP1491 MMP1492 MMP1582 MMP1614 | dys infB cbiL pycB cbiH corA rpoK rpoB2 trzA pyrE pdaD hisS | hypothetical protein | putative deoxyhypusine synthase | translation initiation factor IF-2 | precorrin-2 C-20 methyltransferase | pyruvate carboxylase subunit B | O-sialoglycoprotein endopeptidase/protein kinase | Beta-lactamase-like:KH domain | predicted archaeal transcriptional regulator | precorrin-3B C17-methyltransferase | magnesium, nickel and cobalt transport protein | methyltransferase related protein | DNA-directed RNA polymerase, subunit K | Enolase | ThiamineS | DNA-directed RNA polymerase subunit beta'' | Chlorohydrolase | Orotate phosphoribosyltransferase | pyruvoyl-dependent arginine decarboxylase | histidyl-tRNA synthetase |
| 150 | 17 | 41 | -21.960 | 0.240 | 
Residual = 0.240 |  | 
TaggGggTGtT | 
cTTCatattcCAtAatcCcCTTc |  | Antisense_10 MMP0069 MMP0086 MMP0102 MMP0190 MMP0528 MMP1019 MMP1235 MMP1237 MMP1256 MMP1282 MMP1283 MMP1294 MMP1387 MMP1552 MMP1608 MMP1653 | pcm moaE glgA | methyltransferase | hypothetical protein | Protein-L-isoaspartate(D-aspartate) O-methyltransferase | Molybdopterin biosynthesis MoaE | Glycosyl transferase, group 1 | Flavoprotein:Phenylacrylic acid decarboxylase, 3-octaprenyl-4-hydroxybenzoate carboxy-lyase |
| 151 | 25 | 39 | -8.888 | 0.493 | 
Residual = 0.493 |  | 
CGggGGgA | 
GgCGGcTGgA |  | Antisense_21 MMP0009 MMP0063 MMP0090 MMP0369 MMP0475 MMP0515 MMP0585 MMP0598 MMP0614 MMP0725 MMP0769 MMP0886 MMP0939 MMP1056 MMP1179 MMP1262 MMP1343 MMP1388 MMP1525 MMP1526 MMP1679 RNA_23 RNA_47 Unanno_43 | argB modB Usp and some other nucleotide rncS tRNA-Glu2 rrnB5S | putative DNA primase large subunit | acetylglutamate kinase | Glycosyl transferase | hypothetical protein | Molybdenum ABC transporter, permease protein | Universal stress protein (Usp) | archaeal phosphoglycerate mutase-related | related to iron-sulfur flavoprotein of Methanosarcina thermophila | putative integral membrane protein | cobalt transport system permease related protein | SAM (and some other nucleotide) binding motif:Generic methyltransferase | Redox-active disulfide protein 2 | Modulator of DNA gyrase | Ribonuclease III family:Double-stranded RNA binding (DsRBD) domain | tRNA-Glu | 5S ribosomal RNA |
| 152 | 20 | 38 | -19.527 | 0.248 | 
Residual = 0.248 |  | 
TgctGGAGggA | 
GAAcCAcaCTCcAAA |  | MMP0071 MMP0177 MMP0231 MMP0269 MMP0304 MMP0327 MMP0585 MMP0599 MMP0660 MMP0676 MMP1029 MMP1065 MMP1233 MMP1236 MMP1372 MMP1477 MMP1487 MMP1549 MMP1580 MMP1619 | deoA Usp cbiJ apt P-loop manB cbiA gapN | DNA primase, small subunit | hypothetical protein | N-glycosylase/DNA lyase | thymidine phosphorylase | Universal stress protein (Usp) | Precorrin-6x reductase CbiJ/CobK | adenine phosphoribosyltransferase | Intermediate filament protein:ATP/GTP-binding site motif A (P-loop):AAA ATPase | TonB-dependent receptor protein:Formate dehydrogenase, subunit FdhD | Phosphoglucomutase/phosphomannomutase | Cobyrinic acid a,c-diamide synthase | Aldehyde dehydrogenase | AP endonuclease, family 2 | Dihydropteroate synthase, DHPS:Dihydropteroate synthase-related protein synthase-related protein | Molybdenum cofactor biosynthesis protein:MoeA N-terminal region, domain I and II:MoeA C-terminal, domain IV |
| 153 | 20 | 41 | -20.698 | 0.214 | 
Residual = 0.214 |  | 
CaCCTGTtCtncA | 
GaCGCcCAaG |  | Antisense_8 MMP0128 MMP0193 MMP0207 MMP0307 MMP0426 MMP0499 MMP0522 MMP0523 MMP0524 MMP0527 MMP0775 MMP0871 MMP0994 MMP1202 MMP1203 MMP1238 MMP1494 MMP1578 MMP1636 | Antisense_1 modC cbiD bioB | hypothetical protein | Molybdenum transport ATP-binding protein modC | Nitroreductase family | ABC transporter ATP-binding protein | cobalt-precorrin-6A synthase | TonB-dependent receptor protein:Biotin synthase | Cytidylyltransferase:Cytidyltransferase-related domain | General substrate transporter |
| 154 | 24 | 40 | -14.564 | 0.300 | 
Residual = 0.300 |  | 
AtCCCCc | 
GGGTGGC |  | MMP0299 MMP0303 MMP0332 MMP0416 MMP0445 MMP0532 MMP0601 MMP0712 MMP0724 MMP0726 MMP0734 MMP0753 MMP0754 MMP0798 MMP0826 MMP0827 MMP0846 MMP0944 MMP0972 MMP1276 MMP1632 Unanno_37 Unanno_44 Unanno_58 | yqiX | hypothetical protein | rubredoxin | similar to amino acid ABC transporter substrate-binding protein | Solute-binding protein/glutamate receptor:Bacterial extracellular solute-binding protein, family 3 |
| 155 | 23 | 40 | -18.684 | 0.199 | 
Residual = 0.199 |  | 
TGGGAaAACGG | 
GCCCTG |  | Antisense_18 MMP0032 MMP0197 MMP0201 MMP0494 MMP0495 MMP0497 MMP0586 MMP0771 MMP0774 MMP0780 MMP0782 MMP0786 MMP0803 MMP0804 MMP0805 MMP0807 MMP0834 MMP0869 MMP1037 MMP1055 MMP1571 MMP1596 | III moeA mtbA | ArsR family member | ABC-type iron(III) transport system, permease component | Molybdenum cofactor biosynthesis protein | distinct helicase family member with a unique C-terminal domain including a metal-binding cysteine cluster | hypothetical protein | uncharacterized endonuclease III related protein | Carboxymuconolactone decarboxylase Related Protein | Uroporphyrinogen decarboxylase (URO-D) | Cytidine/deoxycytidylate deaminase, zinc-binding region related protein |
| 156 | 18 | 41 | -17.784 | 0.267 | 
Residual = 0.267 |  | 
ggGGGGA | 
gGGCGgTG |  | MMP0215 MMP0283 MMP0292 MMP0293 MMP0335 MMP0542 MMP0559 MMP0628 MMP0709 MMP0852 MMP0961 MMP0962 MMP0963 MMP1160 MMP1163 MMP1174 MMP1720 MMP1721 | ndk | hypothetical protein | Nucleoside-diphosphate kinase | aldolase | Family of unknown function ThiJ/PfpI | probable Molybdenum-pterin binding protein | zinc finger protein | aquaporin related | CutA1 divalent ion tolerance protein Related Protein | peroxiredoxin |
| 157 | 18 | 37 | -18.371 | 0.256 | 
Residual = 0.256 |  | 
ccagCggCatttCCgCtttcg | 
CCCtCC |  | MMP0131 MMP0185 MMP0222 MMP0328 MMP0329 MMP0330 MMP0357 MMP0358 MMP0390 MMP0706 MMP1024 MMP1121 MMP1132 MMP1133 MMP1264 MMP1344 MMP1500 MMP1521 | mtaP cbiC endA comC ftsz2 | Pyridoxal phosphate-dependent amino acid decarboxylase | 5'-methylthioadenosine phosphorylase | hypothetical protein | precorrin-8X methylmutase | UDP-N-acetylglucosamine 2-epimerase | NAD binding site:UDP-glucose/GDP-mannose dehydrogenase | MCM family related protein | metal-dependent phophohydrolase related protein | tRNA-splicing endonuclease subunit alpha | L-sulfolactate dehydrogenase/(S)-hydroxyglutaric acid dehydrogenase | cell division protein FtsZ |
| 158 | 8 | 39 | -26.939 | 0.081 | 
Residual = 0.081 |  | 
| 
|  | MMP1406 MMP1407 MMP1408 MMP1409 MMP1410 MMP1411 MMP1412 MMP1413 | rps17p rpl14p rpl24p rpl5p rps14P | translation initiation factor Sui1 | ribonuclease P protein component 1 | 30S ribosomal protein S17P | 50S ribosomal protein L14P | 50S ribosomal protein L24P | 30S ribosomal protein S4e | 50S ribosomal protein L5P | 30S ribosomal protein S14P |
| 159 | 16 | 41 | -22.520 | 0.234 | 
Residual = 0.234 |  | 
GGGGGaaT | 
CGgcgcgGgGaGgtAGCCtgGg |  | MMP0115 MMP0190 MMP0496 MMP0543 MMP0546 MMP0710 MMP0785 MMP1012 MMP1164 MMP1256 MMP1293 MMP1329 MMP1331 MMP1332 MMP1338 MMP1553 | dop exoA rdxA | hypothetical protein | Glutamate synthase subunit-related | cation-transporting ATPase | Chymotrypsin serine protease, family S1 | exonuclease III | heavy-metal transport ATPase related protein | Glycosyl transferase, group 1 | ferredoxin | NAD binding site:FAD-dependent pyridine nucleotide-disulphide oxidoreductase | Nitroreductase family |
| 160 | 22 | 37 | -16.033 | 0.326 | 
Residual = 0.326 |  | 
ATgTcgGGtAT | 
cAGGGaggaGG |  | MMP0038 MMP0039 MMP0040 MMP0041 MMP0086 MMP0234 MMP0235 MMP0237 MMP0238 MMP0240 MMP0299 MMP0452 MMP0458 MMP0595 MMP0636 MMP0656 MMP0721 MMP0722 MMP0723 MMP0783 MMP1279 MMP1608 | tfb | hypothetical protein | type II secretion system protein; putative; subunit 1 | transcription initiation factor IIB | ferredoxin | Camphor resistance CrcB protein |
| 161 | 14 | 40 | -27.800 | 0.190 | 
Residual = 0.190 |  | 
CtGGttcAAATCCCGgctggcccA | 
AtTTaTgAGGGGa |  | MMP0107 MMP0484 MMP0519 MMP0560 MMP0767 MMP0769 MMP0782 MMP0790 MMP0896 MMP0973 MMP0974 MMP1078 MMP1285 MMP1536 | and some other nucleotide | hypothetical protein | possible sodium/proton antiporter | SAM (and some other nucleotide) binding motif:Family of unknown function Met10 | Polysaccharide biosynthesis protein |
| 162 | 19 | 37 | -15.974 | 0.294 | 
Residual = 0.294 |  | 
CCaCCtTnTG | 
GaGcGC |  | MMP0100 MMP0101 MMP0352 MMP0567 MMP0568 MMP0603 MMP0681 MMP0701 MMP0702 MMP1030 MMP1031 MMP1286 MMP1360 MMP1422 MMP1435 MMP1436 MMP1714 MMP1715 MMP1716 | aIF-1A adkA rpoH secY secE ftsZ1 hmdII | Na+/H+ exchanger family | hypothetical protein | Putative oxidoreductase | transcriptional regulator related protein | translation initiation factor IF-1A | Xanthine/uracil permease family | adenylate kinase | DNA primase | DNA-directed RNA polymerase subunit H | preprotein translocase subunit SecY | preprotein translocase subunit SecE | cell division protein FtsZ | putative GTPase | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase-related protein |
| 163 | 29 | 39 | -15.762 | 0.419 | 
Residual = 0.419 |  | 
GaAaaTccGataTTttCACCc | 
gcnCGATtcCaaAAC |  | Antisense_18 MMP0188 MMP0361 MMP0362 MMP0365 MMP0366 MMP0367 MMP0368 MMP0379 MMP0424 MMP0454 MMP0524 MMP0525 MMP0594 MMP0665 MMP0690 MMP0775 MMP0784 MMP0794 MMP0828 MMP0845 MMP1027 MMP1119 MMP1125 MMP1309 MMP1389 MMP1423 MMP1501 MMP1655 | yjlA | hypothetical protein | polyferredoxin | putative glycosyl transferase, family 4:Aldehyde dehydrogenase |
| 164 | 14 | 38 | -30.233 | 0.162 | 
Residual = 0.162 |  | 
ACCTACAcAAAcAc | 
AGCtCC |  | MMP0924 MMP0925 MMP0926 MMP0927 MMP1666 MMP1667 MMP1668 MMP1669 MMP1670 MMP1671 MMP1672 MMP1673 MMP1675 MMP1719 | cheW cheB cheA flaB1 flaB2 flaB3 flaC flaD flaE flaF flaG flaI | hypothetical protein | chemotaxis protein CheW | chemotaxis protein CheB | Chemotaxis protein CheA | flagellin | flagella accessory protein C | flagella accessory protein D | flagella accessory protein E | flagella accessory protein F | flagella accessory protein G | flagella accessory protein I |
| 165 | 20 | 40 | -29.844 | 0.226 | 
Residual = 0.226 |  | 
gGgTnGtcnAGcCTG | 
CCgtCtatGCtACC |  | RNA_1 RNA_13 RNA_16 RNA_19 RNA_2 RNA_20 RNA_22 RNA_23 RNA_24 RNA_26 RNA_27 RNA_3 RNA_31 RNA_43 RNA_5 RNA_50 RNA_6 RNA_7 RNA_8 RNA_9 | tRNA-Ala2 tRNA-Ser1 tRNA-Ser2 tRNA-Met1 tRNA-Phe1 tRNA-Met2 tRNA-Glu2 tRNA-Leu2 tRNA-Leu3 tRNA-Val2 tRNA-Ala1 tRNA-Trp tRNA-SeC1 | tRNA-Ala | tRNA-Ser | tRNA-Met | tRNA-Phe | tRNA-Glu | tRNA-Leu | tRNA-Val | tRNA-Trp | tRNA-Sec |
| 166 | 23 | 40 | -19.487 | 0.303 | 
Residual = 0.303 |  | 
ggGGGagtT | 
ctCTTCTCacATAcccccGTA |  | MMP0018 MMP0097 MMP0238 MMP0538 MMP0547 MMP0558 MMP0652 MMP0756 MMP0758 MMP0759 MMP0813 MMP0842 MMP0864 MMP0871 MMP1268 MMP1291 MMP1292 MMP1294 MMP1296 MMP1604 MMP1605 MMP1653 MMP1654 | napA-2 glucoamylase glgA pfkC | Transcriptional regulator, LysR Family Member | Transcriptional regulator protein, Helix-turn-helix motif | hypothetical protein | RecJ related protein | HNH endonuclease:HNH nuclease | Na+/H+ exchanger | Glycoside hydrolase, family 57 | glucan 1,4-alpha-glucosidase (glucoamylase) | Glycosyl transferase, group 1 | ADP-specific phosphofructokinase | Pyruvate kinase |