cluster | n.genes | n.arrays | score | profile | network | motif1 | motif2 | motif.posns | probe.names | short.names | long.names |
1 | 15 | 117 | -10.489 | ![htmls/cluster0001_profile.png](htmls/cluster0001_profile.png) Residual = 0.391 | ![htmls/cluster0001_network.png](htmls/cluster0001_network.png) | ![htmls/cluster0001_pssm1.png](htmls/cluster0001_pssm1.png) GGGtaAAaCCc | ![htmls/cluster0001_pssm2.png](htmls/cluster0001_pssm2.png) AAtgaataGnGGGtnGcaAAA | ![htmls/cluster0001_mot_posns.png](htmls/cluster0001_mot_posns.png) | MPN112 MPN250 MPN302 MPN303 MPN427 MPN430 MPN450 MPN490 MPN495 MPN499 MPN517 MPN607 MPN626 MPN668 MPN674 | pgi pfkA pyk yidA gap orf7 recA pmsR osmC ldh | permease | glucose-6-phosphate isomerase | 6-phosphofructokinase | pyruvate kinase | hydrolase/phosphatase | glyceraldehyde-3-phosphate dehydrogenase | hypothetical protein | recombinase A | similar to PTS system: EIIB | suggest reductase homologue | methionine sulfoxide reductase A | L-lactate dehydrogenase |
2 | 10 | 116 | -11.736 | ![htmls/cluster0002_profile.png](htmls/cluster0002_profile.png) Residual = 0.401 | ![htmls/cluster0002_network.png](htmls/cluster0002_network.png) | ![htmls/cluster0002_pssm1.png](htmls/cluster0002_pssm1.png) TTtAcaatCtCTTTAgTGgTT | ![htmls/cluster0002_pssm2.png](htmls/cluster0002_pssm2.png) CCCAAnGc | ![htmls/cluster0002_mot_posns.png](htmls/cluster0002_mot_posns.png) | MPN048 MPN127 MPN249 MPN345 MPN347 MPN496 MPN510 MPN580 MPN586 MPN589 | yjeQ hsdR ulaA | membrane export protein family | hypothetical protein | conserved hypothetical protein, 154-190 similar to GTP/ATP binding proteins | Type I Restriction Enzyme (fragment) | ascorbate-specific PTS system enzyme IIC |
3 | 8 | 115 | -16.251 | ![htmls/cluster0003_profile.png](htmls/cluster0003_profile.png) Residual = 0.275 | ![htmls/cluster0003_network.png](htmls/cluster0003_network.png) | ![htmls/cluster0003_pssm1.png](htmls/cluster0003_pssm1.png) cCaCCggGTTcAAcCacGcgcgGG | ![htmls/cluster0003_pssm2.png](htmls/cluster0003_pssm2.png) CCTTGA | ![htmls/cluster0003_mot_posns.png](htmls/cluster0003_mot_posns.png) | MPN040 MPN098 MPN102 MPN103 MPN131 MPN371 MPN486 MPN578 | | hypothetical protein | involved in cytadherence |
4 | 9 | 115 | -25.235 | ![htmls/cluster0004_profile.png](htmls/cluster0004_profile.png) Residual = 0.303 | ![htmls/cluster0004_network.png](htmls/cluster0004_network.png) | ![htmls/cluster0004_pssm1.png](htmls/cluster0004_pssm1.png) aCgGGTtcagcctCGcGGGGgC | ![htmls/cluster0004_pssm2.png](htmls/cluster0004_pssm2.png) ctCCcccAcgnTtncgcGCTTntC | ![htmls/cluster0004_mot_posns.png](htmls/cluster0004_mot_posns.png) | MPN128 MPN131 MPN144 MPN286 MPN371 MPN486 MPN513 MPN577 MPN578 | | hypothetical protein |
5 | 11 | 116 | -14.968 | ![htmls/cluster0005_profile.png](htmls/cluster0005_profile.png) Residual = 0.347 | ![htmls/cluster0005_network.png](htmls/cluster0005_network.png) | ![htmls/cluster0005_pssm1.png](htmls/cluster0005_pssm1.png) TgGagTcctGgagAAGcttAG | ![htmls/cluster0005_pssm2.png](htmls/cluster0005_pssm2.png) GCGgTTCC | ![htmls/cluster0005_mot_posns.png](htmls/cluster0005_mot_posns.png) | MPN154 MPN164 MPN173 MPN177 MPN181 MPN183 MPN225 MPN226 MPN325 MPN352 MPN357 | nusA rpsJ rpmC rplE rplR rplO rpsL rpsG rplU sigA lig | transcription elongation factor NusA | 30S ribosomal protein S10 | 50S ribosomal protein L29 | 50S ribosomal protein L5 | 50S ribosomal protein L18 | 50S ribosomal protein L15 | 30S ribosomal protein S12 | 30S ribosomal protein S7 | 50S ribosomal protein L21 | RNA polymerase sigma factor RpoD | DNA ligase |
6 | 2 | 114 | -8.682 | ![htmls/cluster0006_profile.png](htmls/cluster0006_profile.png) Residual = 0.112 | ![htmls/cluster0006_network.png](htmls/cluster0006_network.png) | ![htmls/cluster0006_pssm1.png](htmls/cluster0006_pssm1.png)
| ![htmls/cluster0006_pssm2.png](htmls/cluster0006_pssm2.png)
| ![htmls/cluster0006_mot_posns.png](htmls/cluster0006_mot_posns.png) | MPN167 MPN173 | rplW rpmC | 50S ribosomal protein L23 | 50S ribosomal protein L29 |
7 | 30 | 122 | -7.532 | ![htmls/cluster0007_profile.png](htmls/cluster0007_profile.png) Residual = 0.577 | ![htmls/cluster0007_network.png](htmls/cluster0007_network.png) | ![htmls/cluster0007_pssm1.png](htmls/cluster0007_pssm1.png) GCtCcCAAaTTngttTaAAtT | ![htmls/cluster0007_pssm2.png](htmls/cluster0007_pssm2.png) ACTTgtAGTAGCTCAaAGatAAca | ![htmls/cluster0007_mot_posns.png](htmls/cluster0007_mot_posns.png) | MPN016 MPN028 MPN047 MPN148 MPN234 MPN289 MPN358 MPN400 MPN401 MPN424 MPN425 MPN426 MPN447 MPN452 MPN453 MPN454 MPN456 MPN458 MPN459 MPN501 MPN504 MPN509 MPN512 MPN521 MPN522 MPN575 MPN593 MPN617 MPN637 MPN685 | rimK trsB hsdS1B greA ylxM ftsY hmw1 hmw3 ygl3 rplM cdsA cysA | similar to ribosomal S6 modification protein | sugar transferase | hypothetical protein | membrane export protein family | this protein specifications means only that it is a type I restriction with enzyme ecokI specificity protein | transcription elongation factor GreA | cell division protein FtsY | SMC family, chromosome/DNA binding/protecting functions | cytadherence accessory protein HMW1 | cytadherence accessory protein HMW3 | 30K adhesin-related protein | putative rRNA methylase | similar to methyltransferase | 50S ribosomal protein L13 | CDP-diglyceride synthetase | sulfate transport ATP-binding protein |
8 | 5 | 112 | -6.241 | ![htmls/cluster0008_profile.png](htmls/cluster0008_profile.png) Residual = 0.176 | ![htmls/cluster0008_network.png](htmls/cluster0008_network.png) | ![htmls/cluster0008_pssm1.png](htmls/cluster0008_pssm1.png)
| ![htmls/cluster0008_pssm2.png](htmls/cluster0008_pssm2.png)
| ![htmls/cluster0008_mot_posns.png](htmls/cluster0008_mot_posns.png) | MPN165 MPN168 MPN169 MPN170 MPN171 | rplC rplB rpsS rplV rpsC | 50S ribosomal protein L3 | 50S ribosomal protein L2 | 30S ribosomal protein S19 | 50S ribosomal protein L22 | 30S ribosomal protein S3 |
9 | 28 | 122 | -8.325 | ![htmls/cluster0009_profile.png](htmls/cluster0009_profile.png) Residual = 0.541 | ![htmls/cluster0009_network.png](htmls/cluster0009_network.png) | ![htmls/cluster0009_pssm1.png](htmls/cluster0009_pssm1.png) TaAACCgGtaAaTTcAaTTAGTgT | ![htmls/cluster0009_pssm2.png](htmls/cluster0009_pssm2.png) aAAAAAAGgA | ![htmls/cluster0009_mot_posns.png](htmls/cluster0009_mot_posns.png) | MPN011 MPN012 MPN051 MPN084 MPN105 MPN107 MPN118 MPN137 MPN138 MPN161 MPN204 MPN214 MPN271 MPN344 MPN369 MPN386 MPN411 MPN417 MPN466 MPN467 MPN498 MPN505 MPN528 MPN530 MPN561 MPN592 MPN638 MPN653 | glpD pheS yaaF P69 araD ppa udk mtlF | hypothetical protein | glycerol-3-phospate dehydrogenase | phenylalanyl-tRNA synthetase subunit alpha | Similarity with Ribonuclease HII | DEOXYGUANOSINE KINASE/ DEOXYADENOSINE KINASE | transport system permease protein P69 | L-ribulose-5-phosphate 4-epimerase | inorganic pyrophosphatase | uridine kinase | specificity determining subunit for restriction enzyme belonging to the K family of S proteins | PTS system mannitol-specific component IIA (EIIA-MTL) |
10 | 23 | 123 | -12.188 | ![htmls/cluster0010_profile.png](htmls/cluster0010_profile.png) Residual = 0.533 | ![htmls/cluster0010_network.png](htmls/cluster0010_network.png) | ![htmls/cluster0010_pssm1.png](htmls/cluster0010_pssm1.png) CaGCAatnCCGCnAa | ![htmls/cluster0010_pssm2.png](htmls/cluster0010_pssm2.png) AGCtCCCAAA | ![htmls/cluster0010_mot_posns.png](htmls/cluster0010_mot_posns.png) | MPN011 MPN012 MPN119 MPN120 MPN121 MPN239 MPN240 MPN245 MPN270 MPN331 MPN363 MPN408 MPN431 MPN433 MPN456 MPN501 MPN545 MPN547 MPN548 MPN551 MPN556 MPN621 MPN636 | grpE trxB def tig cbiO rnc argS frr | hypothetical protein | contains j-domain of DnaJ; and a domain common to cytadherence proteins | heat shock protein GrpE | thioredoxin reductase | peptide deformylase | trigger factor | permease | abc transport ATP-binding protein | ribonuclease III | dihydroacetone kinase | pseudouridine synthase | arginyl-tRNA synthetase | similar to metallo hydrolase | ribosome releasing factor |
11 | 16 | 118 | -8.181 | ![htmls/cluster0011_profile.png](htmls/cluster0011_profile.png) Residual = 0.375 | ![htmls/cluster0011_network.png](htmls/cluster0011_network.png) | ![htmls/cluster0011_pssm1.png](htmls/cluster0011_pssm1.png) AAAcCAaAAntgCCA | ![htmls/cluster0011_pssm2.png](htmls/cluster0011_pssm2.png) cAGCGCCcAAc | ![htmls/cluster0011_mot_posns.png](htmls/cluster0011_mot_posns.png) | MPN014 MPN042 MPN085 MPN112 MPN304 MPN305 MPN373 MPN374 MPN421 MPN438 MPN490 MPN535 MPN536 MPN587 MPN626 MPN639 | dnaE group2 arcA recA ruvA ruvB | hypothetical protein | adhesin P1 (group2) homolog | permease | (N-terminal, fragment) | (C-terminal, fragment) | recombinase A | Holliday junction DNA helicase motor protein | Holliday junction DNA helicase B |
12 | 26 | 120 | -16.848 | ![htmls/cluster0012_profile.png](htmls/cluster0012_profile.png) Residual = 0.499 | ![htmls/cluster0012_network.png](htmls/cluster0012_network.png) | ![htmls/cluster0012_pssm1.png](htmls/cluster0012_pssm1.png) CagCATtGGGgtTgcTagTtAcC | ![htmls/cluster0012_pssm2.png](htmls/cluster0012_pssm2.png) AaGTTGATgcACCtnAaAaCGttG | ![htmls/cluster0012_mot_posns.png](htmls/cluster0012_mot_posns.png) | MPN003 MPN046 MPN158 MPN180 MPN181 MPN182 MPN185 MPN186 MPN187 MPN189 MPN193 MPN209 MPN217 MPN218 MPN222 MPN229 MPN230 MPN231 MPN232 MPN253 MPN256 MPN257 MPN279 MPN469 MPN480 MPN671 | gyrB aspS yaaC rplF rplR rpsE adk map infA rpsM CbiO mgtA oppD oppF yacA ssb rpsR rplI dnaB pgsA galE lepA valS ftsH | DNA gyrase subunit B | aspartyl-tRNA synthetase | riboflavin kinase (flavokinase)/FMN adenylyltransferase (FAD pyrophosphorylase) (FAD synthetase); bifunctional | 50S ribosomal protein L6 | 50S ribosomal protein L18 | 30S ribosomal protein S5 | adenylate kinase | methionine amino peptidase | initiation factor 1 | 30S ribosomal protein S13 | cobalt transport ATP-binding protein | cation-transporting P-type ATPase | oligopeptide transport ATP-binding protein OppD | but only N- and C-term; inbetween (500AA) seg and coil | similar to PP-loop superfamily ATPase/cell cycle protein MESJ homologues | single-stranded DNA binding protein | 30S ribosomal protein S18 | 50S ribosomal protein L9 | replicative DNA helicase DnaB | phosphatidylglycerophosphate synthase | hypothetical protein | UDP-glucose 4-epimerase | GTP-binding protein LepA | valyl-tRNA synthetase | cell division protein FtsH |
13 | 17 | 120 | -7.134 | ![htmls/cluster0013_profile.png](htmls/cluster0013_profile.png) Residual = 0.471 | ![htmls/cluster0013_network.png](htmls/cluster0013_network.png) | ![htmls/cluster0013_pssm1.png](htmls/cluster0013_pssm1.png) CaAgtTagTTAGCG | ![htmls/cluster0013_pssm2.png](htmls/cluster0013_pssm2.png) GGTTTGCGG | ![htmls/cluster0013_mot_posns.png](htmls/cluster0013_mot_posns.png) | MPN002 MPN083 MPN124 MPN127 MPN246 MPN247 MPN248 MPN297 MPN298 MPN299 MPN300 MPN301 MPN398 MPN407 MPN473 MPN479 MPN648 | xdj1 hrcA gmk ptc1 acpS plsB scpA scpB lip2 | similar to j-domain of DnaJ | hypothetical protein | heat-inducible transcription repressor | membrane-associated guanylate kinase homologue | protein phoshatase 2C homolog; similar to Swiss-Prot Accession Number P35182, from S. cerevisiae | Ser/Thr/Tyr protein kinase | 4'-phosphopantetheinyl transferase | 1-acyl-sn-glycerol-3-phosphate acyltransferase | segregation and condensation protein A/unknown domain fusion protein | segregation and condensation protein B | lipase | triacylglycerol lipase (lip) 2 | ACYL CARRIER PROTEIN PHOSPHODIESTERASE |
14 | 23 | 124 | -11.282 | ![htmls/cluster0014_profile.png](htmls/cluster0014_profile.png) Residual = 0.442 | ![htmls/cluster0014_network.png](htmls/cluster0014_network.png) | ![htmls/cluster0014_pssm1.png](htmls/cluster0014_pssm1.png) gAAgCCcAcCAcTtCagCCac | ![htmls/cluster0014_pssm2.png](htmls/cluster0014_pssm2.png) TTAgctACaTtAGtAaGcTaatA | ![htmls/cluster0014_mot_posns.png](htmls/cluster0014_mot_posns.png) | MPN004 MPN078 MPN143 MPN148 MPN199 MPN223 MPN319 MPN379 MPN395 MPN432 MPN449 MPN457 MPN458 MPN459 MPN480 MPN481 MPN482 MPN519 MPN525 MPN541 MPN542 MPN543 MPN619 | gyrA fruA gap1 polA apt artP orf8 valS yihA lip3 rpsT fmt uvrA | DNA gyrase subunit A | fructose-permease IIBC component | hypothetical protein | HPr kinase/phosphorylase | general amino acid permease GAP1 homolog; similar to Swiss-Prot Accession Number P19145, from S. cerevisiae | 5'-3' exonuclease (complete) | adenine phosphoribosyltransferase | abc transport ATP-binding protein | valyl-tRNA synthetase | GTPase EngB | triacylglycerol lipase (lip) 3 | 30S ribosomal protein S20 | methionyl-tRNA formyltransferase | excinuclease ABC subunit A |
15 | 18 | 118 | -11.355 | ![htmls/cluster0015_profile.png](htmls/cluster0015_profile.png) Residual = 0.407 | ![htmls/cluster0015_network.png](htmls/cluster0015_network.png) | ![htmls/cluster0015_pssm1.png](htmls/cluster0015_pssm1.png) cCaCCgGGTTcAagCtcGCgggG | ![htmls/cluster0015_pssm2.png](htmls/cluster0015_pssm2.png) TcCcaCacCtCCccCaCG | ![htmls/cluster0015_mot_posns.png](htmls/cluster0015_mot_posns.png) | MPN040 MPN042 MPN049 MPN103 MPN144 MPN160 MPN206 MPN286 MPN356 MPN370 MPN409 MPN438 MPN451 MPN463 MPN486 MPN503 MPN513 MPN577 | cysS come3 | hypothetical protein | membrane export protein family | cysteinyl-tRNA synthetase | competence locus operon protein 3 homolog; similar to Swiss-Prot Accession Number P39695, from B. subtilis | protein family involved in cytadherence |
16 | 18 | 120 | -10.891 | ![htmls/cluster0016_profile.png](htmls/cluster0016_profile.png) Residual = 0.442 | ![htmls/cluster0016_network.png](htmls/cluster0016_network.png) | ![htmls/cluster0016_pssm1.png](htmls/cluster0016_pssm1.png) AAAacgatcanGaTtGgnAA | ![htmls/cluster0016_pssm2.png](htmls/cluster0016_pssm2.png) CCACCCCttaatCC | ![htmls/cluster0016_mot_posns.png](htmls/cluster0016_mot_posns.png) | MPN032 MPN124 MPN126 MPN250 MPN251 MPN302 MPN303 MPN304 MPN376 MPN403 MPN427 MPN450 MPN479 MPN495 MPN517 MPN611 MPN668 MPN674 | hrcA pgi cfxE pfkA pyk arcA yidA orf7 osmC ldh | hydrolase | heat-inducible transcription repressor | hypothetical protein | glucose-6-phosphate isomerase | ribulose-phosphate 3-epimerase | 6-phosphofructokinase | pyruvate kinase | (N-terminal, fragment) | hydrolase/phosphatase | ACYL CARRIER PROTEIN PHOSPHODIESTERASE | similar to PTS system: EIIB | suggest reductase homologue | similar to phosphate binding protein Psts | L-lactate dehydrogenase |
17 | 8 | 115 | -3.156 | ![htmls/cluster0017_profile.png](htmls/cluster0017_profile.png) Residual = 0.305 | ![htmls/cluster0017_network.png](htmls/cluster0017_network.png) | ![htmls/cluster0017_pssm1.png](htmls/cluster0017_pssm1.png)
| ![htmls/cluster0017_pssm2.png](htmls/cluster0017_pssm2.png)
| ![htmls/cluster0017_mot_posns.png](htmls/cluster0017_mot_posns.png) | MPN215 MPN216 MPN217 MPN227 MPN232 MPN538 MPN539 MPN540 | oppB amiD oppD fus dnaB rplJ rplL rpmF | oligopeptide transport system permease protein OppB | oligopeptide transport system permease protein AmiD | oligopeptide transport ATP-binding protein OppD | elongation factor G | replicative DNA helicase DnaB | 50S ribosomal protein L10 | 50S ribosomal protein L7/L12 | 50S ribosomal protein L32 |
18 | 42 | 130 | -6.238 | ![htmls/cluster0018_profile.png](htmls/cluster0018_profile.png) Residual = 0.488 | ![htmls/cluster0018_network.png](htmls/cluster0018_network.png) | ![htmls/cluster0018_pssm1.png](htmls/cluster0018_pssm1.png) TgaGCAgCagtgtTGcAAgtaG | ![htmls/cluster0018_pssm2.png](htmls/cluster0018_pssm2.png) TTgaTGGTGGA | ![htmls/cluster0018_mot_posns.png](htmls/cluster0018_mot_posns.png) | MPN016 MPN020 MPN024 MPN038 MPN039 MPN070 MPN086 MPN087 MPN104 MPN109 MPN133 MPN138 MPN145 MPN163 MPN212 MPN254 MPN262 MPN263 MPN264 MPN309 MPN337 MPN347 MPN363 MPN364 MPN365 MPN380 MPN385 MPN439 MPN461 MPN504 MPN514 MPN521 MPN529 MPN542 MPN570 MPN612 MPN613 MPN614 MPN615 MPN636 MPN649 MPN676 | rimK yb95 rpoE group2 A65_orf475 trx P65 hsdR fpg ktrA ygl3 hsdS frr K05_orf106 | similar to ribosomal S6 modification protein | similar to helicases | DNA-directed RNA polymerase subunit delta | hypothetical protein | adhesin P1 (group2) homolog | C09_orf165 Protein | putative lipoprotein | conserved hypothetical protein, similar to reticulocyte binding protein | thioredoxin | 150-end, similar to phosphate hydrolising | Type I Restriction Enzyme (fragment) | formamidopyrimidine-DNA glycosylase | KtrA, K+ Na+ uptake | putative rRNA methylase | bacterial histone like protein | ribosome releasing factor |
19 | 18 | 120 | -14.184 | ![htmls/cluster0019_profile.png](htmls/cluster0019_profile.png) Residual = 0.484 | ![htmls/cluster0019_network.png](htmls/cluster0019_network.png) | ![htmls/cluster0019_pssm1.png](htmls/cluster0019_pssm1.png) CcCcgggTTcgaccaagcagGGg | ![htmls/cluster0019_pssm2.png](htmls/cluster0019_pssm2.png) cCCCCCAaGactTCC | ![htmls/cluster0019_mot_posns.png](htmls/cluster0019_mot_posns.png) | MPN059 MPN092 MPN093 MPN099 MPN132 MPN149 MPN150 MPN159 MPN202 MPN203 MPN206 MPN292 MPN463 MPN464 MPN468 MPN500 MPN502 MPN503 | gcp hlyC yceC | O-sialoglycoprotein endopeptidase | involved in cytadherence | hypothetical protein | tlyC homolog, hemolysin activity doubtful | similar to RIBOSOMAL LARGE SUBUNIT PSEUDOURIDINE SYNTHASE D | protein family involved in cytadherence |
20 | 20 | 119 | -7.662 | ![htmls/cluster0020_profile.png](htmls/cluster0020_profile.png) Residual = 0.470 | ![htmls/cluster0020_network.png](htmls/cluster0020_network.png) | ![htmls/cluster0020_pssm1.png](htmls/cluster0020_pssm1.png) GCaCaACanttctAngTGC | ![htmls/cluster0020_pssm2.png](htmls/cluster0020_pssm2.png) GGtGtTgTtT | ![htmls/cluster0020_mot_posns.png](htmls/cluster0020_mot_posns.png) | MPN043 MPN067 MPN154 MPN207 MPN224 MPN225 MPN226 MPN244 MPN280 MPN310 MPN311 MPN327 MPN357 MPN361 MPN389 MPN390 MPN391 MPN663 MPN664 MPN665 | glpF nusG nusA ptsG lgt rpsL rpsG DNA SwissProt HMW2_MYCPN rpmA lig prfA lplA pdhD pdhC degV tuf | glycerol uptake facilitator | transcription antitermination factor | transcription elongation factor NusA | PTS system, glucose-specific IIABC component | prolipoprotein diacylglyceryl transferase | 30S ribosomal protein S12 | 30S ribosomal protein S7 | hypothetical protein | similar to single stranded RNA(DNA) processing enzyme | Cytadherence High Molecular Weight Protein 2 (SwissProt HMW2_MYCPN) | 50S ribosomal protein L27 | DNA ligase | peptide chain release factor 1 | lipoate protein ligase | dihydrolipoamide dehydrogenase | branched-chain alpha-keto acid dehydrogenase subunit E2 | elongation factor Tu |
21 | 32 | 122 | -8.660 | ![htmls/cluster0021_profile.png](htmls/cluster0021_profile.png) Residual = 0.523 | ![htmls/cluster0021_network.png](htmls/cluster0021_network.png) | ![htmls/cluster0021_pssm1.png](htmls/cluster0021_pssm1.png) CcAAAAAAGCAAAattaAaGA | ![htmls/cluster0021_pssm2.png](htmls/cluster0021_pssm2.png) TCACCCTTgTcAGatgCtTcatcG | ![htmls/cluster0021_mot_posns.png](htmls/cluster0021_mot_posns.png) | MPN011 MPN018 MPN029 MPN030 MPN050 MPN051 MPN070 MPN119 MPN120 MPN200 MPN240 MPN241 MPN245 MPN254 MPN262 MPN263 MPN264 MPN273 MPN275 MPN331 MPN363 MPN369 MPN380 MPN394 MPN397 MPN460 MPN514 MPN518 MPN529 MPN542 MPN636 MPN654 | pmd1 efp glpK glpD grpE trxB def A65_orf475 trx hit1 yaaK tig fpg nox spoT ktrB frr | hypothetical protein | transport ATP-binding protein | elongation factor P | glycerol kinase | glycerol-3-phospate dehydrogenase | contains j-domain of DnaJ; and a domain common to cytadherence proteins | heat shock protein GrpE | thioredoxin reductase | peptide deformylase | conserved hypothetical protein, similar to reticulocyte binding protein | thioredoxin | 150-end, similar to phosphate hydrolising | nucleotidyl hydrolase/transferase | trigger factor | formamidopyrimidine-DNA glycosylase | NADH oxidase | p)ppGpp 3'-pyrophosphohydrolase | Trk-type K+ transport systems, membrane components | bacterial histone like protein | ribosome releasing factor |
22 | 36 | 122 | -3.824 | ![htmls/cluster0022_profile.png](htmls/cluster0022_profile.png) Residual = 0.477 | ![htmls/cluster0022_network.png](htmls/cluster0022_network.png) | ![htmls/cluster0022_pssm1.png](htmls/cluster0022_pssm1.png) GgtcGnGgAaGGGGtaaggg | ![htmls/cluster0022_pssm2.png](htmls/cluster0022_pssm2.png) CCtCgAanaagCcatCCangaCC | ![htmls/cluster0022_mot_posns.png](htmls/cluster0022_mot_posns.png) | MPN005 MPN007 MPN009 MPN031 MPN041 MPN042 MPN082 MPN085 MPN102 MPN128 MPN149 MPN202 MPN287 MPN292 MPN374 MPN375 MPN376 MPN382 MPN384 MPN409 MPN450 MPN463 MPN476 MPN478 MPN488 MPN503 MPN536 MPN585 MPN587 MPN595 MPN639 MPN640 MPN642 MPN643 MPN644 MPN656 | serS holB yabD tklB group2 yceC leuS orf7 cmk ruvB lacA rbgA | seryl-tRNA synthetase | DNA polymerase III subunit delta' | hydrolase | hypothetical protein | transketolase | adhesin P1 (group2) homolog | involved in cytadherence | similar to RIBOSOMAL LARGE SUBUNIT PSEUDOURIDINE SYNTHASE D | leucyl-tRNA synthetase | cytidylate kinase | NifU-like protein | protein family involved in cytadherence | Holliday junction DNA helicase B | ribose-5-phosphate isomerase B | ribosomal biogenesis GTPase |
23 | 4 | 115 | -6.506 | ![htmls/cluster0023_profile.png](htmls/cluster0023_profile.png) Residual = 0.171 | ![htmls/cluster0023_network.png](htmls/cluster0023_network.png) | ![htmls/cluster0023_pssm1.png](htmls/cluster0023_pssm1.png)
| ![htmls/cluster0023_pssm2.png](htmls/cluster0023_pssm2.png)
| ![htmls/cluster0023_mot_posns.png](htmls/cluster0023_mot_posns.png) | MPN165 MPN166 MPN168 MPN169 | rplC rplD rplB rpsS | 50S ribosomal protein L3 | 50S ribosomal protein L4 | 50S ribosomal protein L2 | 30S ribosomal protein S19 |
24 | 8 | 116 | -20.618 | ![htmls/cluster0024_profile.png](htmls/cluster0024_profile.png) Residual = 0.322 | ![htmls/cluster0024_network.png](htmls/cluster0024_network.png) | ![htmls/cluster0024_pssm1.png](htmls/cluster0024_pssm1.png) CAAGCtgGttttaAagTTGCTAag | ![htmls/cluster0024_pssm2.png](htmls/cluster0024_pssm2.png) CAGTtTtAGC | ![htmls/cluster0024_mot_posns.png](htmls/cluster0024_mot_posns.png) | MPN058 MPN164 MPN197 MPN215 MPN236 MPN237 MPN238 MPN340 | rpsJ pepF oppB gatA gatB pcrA | hypothetical protein | 30S ribosomal protein S10 | oligoendopeptidase F | oligopeptide transport system permease protein OppB | aspartyl/glutamyl-tRNA amidotransferase subunit C-like protein | aspartyl/glutamyl-tRNA amidotransferase subunit A | aspartyl/glutamyl-tRNA amidotransferase subunit B | DNA helicase II |
25 | 27 | 122 | -7.820 | ![htmls/cluster0025_profile.png](htmls/cluster0025_profile.png) Residual = 0.516 | ![htmls/cluster0025_network.png](htmls/cluster0025_network.png) | ![htmls/cluster0025_pssm1.png](htmls/cluster0025_pssm1.png) ACCgcAaAccaaCaGCCcCcAA | ![htmls/cluster0025_pssm2.png](htmls/cluster0025_pssm2.png) CAAgCACCgcGGC | ![htmls/cluster0025_mot_posns.png](htmls/cluster0025_mot_posns.png) | MPN045 MPN049 MPN192 MPN242 MPN278 MPN291 MPN293 MPN306 MPN377 MPN378 MPN392 MPN393 MPN394 MPN396 MPN412 MPN420 MPN421 MPN465 MPN490 MPN496 MPN497 MPN535 MPN625 MPN645 MPN646 MPN647 MPN651 | hisS rplQ secG yefE lspA argI dnaE pdhB pdhA nox F11_orf887 glpQ recA ulaA ruvA mtlA | histidyl-tRNA synthetase | membrane export protein family | 50S ribosomal protein L17 | preprotein translocase subunit SecG | udp-galactopyranose mutase | hypothetical protein | signal peptidase II | less (fragment) | DNA polymerase III alpha subunit | pyruvate dehydrogenase E1-beta subunit | Pyruvate dehydrogenase | NADH oxidase | protein export, secD like | glycerophosphoryl diester phosphodiesterase | permease | recombinase A | ascorbate-specific PTS system enzyme IIC | similar to PHOSPHOTRIESTERASE HOMOLOGY PROTEIN | Holliday junction DNA helicase motor protein | osmotical inducible protein C like family; inducable by osmotic stress and by organic hydroperoxides | similar to mannitol-specific PRS EIIBC |
26 | 23 | 118 | -6.598 | ![htmls/cluster0026_profile.png](htmls/cluster0026_profile.png) Residual = 0.520 | ![htmls/cluster0026_network.png](htmls/cluster0026_network.png) | ![htmls/cluster0026_pssm1.png](htmls/cluster0026_pssm1.png) cGCAAAac | ![htmls/cluster0026_pssm2.png](htmls/cluster0026_pssm2.png) AGCTTaaCCCATGTTGaTg | ![htmls/cluster0026_mot_posns.png](htmls/cluster0026_mot_posns.png) | MPN001 MPN002 MPN048 MPN127 MPN298 MPN299 MPN300 MPN301 MPN318 MPN333 MPN334 MPN335 MPN345 MPN350 MPN398 MPN440 MPN473 MPN477 MPN523 MPN589 MPN680 MPN686 MPN687 | dnaN xdj1 acpS plsB scpA scpB F10_orf750 bcrA hsdR ygiH lip2 dnaA | DNA polymerase III beta subunit | similar to j-domain of DnaJ | membrane export protein family | hypothetical protein | 4'-phosphopantetheinyl transferase | 1-acyl-sn-glycerol-3-phosphate acyltransferase | segregation and condensation protein A/unknown domain fusion protein | segregation and condensation protein B | amino acid permease | ABC transporter ATP-binding protein | Type I Restriction Enzyme (fragment) | triacylglycerol lipase (lip) 2 | probably membrane component, similar to STARP antigen | putative inner membrane protein translocase component YidC | chromosomal replication initiation protein |
27 | 3 | 112 | -17.575 | ![htmls/cluster0027_profile.png](htmls/cluster0027_profile.png) Residual = 0.168 | ![htmls/cluster0027_network.png](htmls/cluster0027_network.png) | ![htmls/cluster0027_pssm1.png](htmls/cluster0027_pssm1.png) CCAcCAcCgGG | ![htmls/cluster0027_pssm2.png](htmls/cluster0027_pssm2.png) CCCCTCC | ![htmls/cluster0027_mot_posns.png](htmls/cluster0027_mot_posns.png) | MPN098 MPN102 MPN128 | | hypothetical protein | involved in cytadherence |
28 | 36 | 125 | -5.840 | ![htmls/cluster0028_profile.png](htmls/cluster0028_profile.png) Residual = 0.590 | ![htmls/cluster0028_network.png](htmls/cluster0028_network.png) | ![htmls/cluster0028_pssm1.png](htmls/cluster0028_pssm1.png) aCCcCaattAGTTGc | ![htmls/cluster0028_pssm2.png](htmls/cluster0028_pssm2.png) CCnCAAagACAGCCACC | ![htmls/cluster0028_mot_posns.png](htmls/cluster0028_mot_posns.png) | MPN002 MPN010 MPN018 MPN019 MPN029 MPN050 MPN061 MPN106 MPN113 MPN114 MPN267 MPN268 MPN278 MPN332 MPN354 MPN415 MPN416 MPN423 MPN434 MPN435 MPN440 MPN457 MPN474 MPN475 MPN552 MPN553 MPN554 MPN555 MPN556 MPN572 MPN574 MPN606 MPN623 MPN625 MPN641 MPN662 | xdj1 pmd1 msbA efp glpK ffh pheT cpt2 ppnK yefE lon grs1 P37 P29 dnaK engA thrSv argS groES eno deaD pilB | similar to j-domain of DnaJ | hypothetical protein | transport ATP-binding protein | elongation factor P | glycerol kinase | signal recognition particle protein | phenylalanyl-tRNA synthetase subunit beta | Similarity to G3P transporters | Acyltransferase | inorganic polyphosphate/ATP-NAD kinase | similar to PTS system: EIIB and N-term part of EIIC; bidomainal | udp-galactopyranose mutase | ATP-dependent protease Lon | glycyl-tRNA synthetase | high affinity transport system protein P37 | ATP-binding protein P29 | molecular chaperone DnaK | permease | coiled coil protein, putative structural protein involved in cytosceleton | GTP-binding protein EngA | threonyl-tRNA synthetase | arginyl-tRNA synthetase | leucyl aminopeptidase | co-chaperonin GroES | phosphopyruvate hydratase | similar to ATP-dependent RNA helicase deaD | osmotical inducible protein C like family; inducable by osmotic stress and by organic hydroperoxides | methionine sulfoxide reductase B |
29 | 33 | 123 | -10.430 | ![htmls/cluster0029_profile.png](htmls/cluster0029_profile.png) Residual = 0.543 | ![htmls/cluster0029_network.png](htmls/cluster0029_network.png) | ![htmls/cluster0029_pssm1.png](htmls/cluster0029_pssm1.png) cCCAaTcCnGggGttAACgCCAtA | ![htmls/cluster0029_pssm2.png](htmls/cluster0029_pssm2.png) CCACTTaAGGTGGTTgTTT | ![htmls/cluster0029_mot_posns.png](htmls/cluster0029_mot_posns.png) | MPN032 MPN033 MPN074 MPN082 MPN105 MPN111 MPN118 MPN126 MPN132 MPN140 MPN250 MPN251 MPN252 MPN313 MPN392 MPN393 MPN403 MPN404 MPN405 MPN428 MPN429 MPN430 MPN479 MPN492 MPN493 MPN494 MPN495 MPN498 MPN499 MPN527 MPN622 MPN623 MPN626 | upp smpB tklB pheS orf4 pgi cfxE asnC pdhB pdhA eutD pgk gap yjfW ulaD yjfU araD rpsO deaD | hydrolase | uracil phosphoribosyltransferase | SsrA-binding protein | transketolase | phenylalanyl-tRNA synthetase subunit alpha | hypothetical protein | Similarity with Ribonuclease HII | DHH family phosphoesterase | glucose-6-phosphate isomerase | ribulose-phosphate 3-epimerase | asparaginyl-tRNA synthetase | pyruvate dehydrogenase E1-beta subunit | Pyruvate dehydrogenase | phosphotransacetylase | phosphoglycerate kinase | glyceraldehyde-3-phosphate dehydrogenase | ACYL CARRIER PROTEIN PHOSPHODIESTERASE | L-xylulose 5-phosphate 3-epimerase | 3-keto-L-gulonate-6-phosphate decarboxylase | similar to phosphotransferase protein II, component A, for pentitol, SGAT homolog | similar to PTS system: EIIB | L-ribulose-5-phosphate 4-epimerase | putative membrane integrated oxidoreductase | 30S ribosomal protein S15 | similar to ATP-dependent RNA helicase deaD |
30 | 29 | 127 | -7.253 | ![htmls/cluster0030_profile.png](htmls/cluster0030_profile.png) Residual = 0.567 | ![htmls/cluster0030_network.png](htmls/cluster0030_network.png) | ![htmls/cluster0030_pssm1.png](htmls/cluster0030_pssm1.png) GCCCAGTCAAGGGGTGAACCCCAC | ![htmls/cluster0030_pssm2.png](htmls/cluster0030_pssm2.png) CnAAnctaaaaCCTT | ![htmls/cluster0030_mot_posns.png](htmls/cluster0030_mot_posns.png) | MPN090 MPN162 MPN164 MPN175 MPN188 MPN208 MPN210 MPN219 MPN220 MPN228 MPN234 MPN255 MPN309 MPN314 MPN408 MPN452 MPN453 MPN454 MPN481 MPN491 MPN509 MPN511 MPN512 MPN621 MPN622 MPN624 MPN670 MPN684 MPN685 | group2 rpsJ rplN rpmJ rpsB secA rplK rplA rpsF P65 yabB hmw3 yihA rpsO rpmB cysA | adhesin P1 (group2) homolog | hypothetical protein | 30S ribosomal protein S10 | 50S ribosomal protein L14 | 50S ribosomal protein L36 | 30S ribosomal protein S2 | preprotein translocase subunit SecA | 50S ribosomal protein L11 | 50S ribosomal protein L1 | 30S ribosomal protein S6 | membrane export protein family | cytadherence accessory protein HMW3 | 30K adhesin-related protein | GTPase EngB | membrane nuclease | similar to metallo hydrolase | 30S ribosomal protein S15 | 50S ribosomal protein L28 | conserved hypothetical protein, suggestion: membrane transporter component | sulfate transport ATP-binding protein |
31 | 21 | 120 | -9.674 | ![htmls/cluster0031_profile.png](htmls/cluster0031_profile.png) Residual = 0.511 | ![htmls/cluster0031_network.png](htmls/cluster0031_network.png) | ![htmls/cluster0031_pssm1.png](htmls/cluster0031_pssm1.png) GtgTTTGC | ![htmls/cluster0031_pssm2.png](htmls/cluster0031_pssm2.png) AAaaAAAGgngtTTaActGacCT | ![htmls/cluster0031_mot_posns.png](htmls/cluster0031_mot_posns.png) | MPN036 MPN121 MPN133 MPN134 MPN135 MPN244 MPN264 MPN314 MPN315 MPN316 MPN317 MPN322 MPN431 MPN432 MPN433 MPN436 MPN472 MPN568 MPN569 MPN666 MPN667 | ugpC ugpA yabB yabC ftsZ nrdF artP cbiO degV spg gtaB | hypothetical protein | putative lipoprotein | sn-glycerol-3-phosphate transport system permease protein | 150-end, similar to phosphate hydrolising | SAM-Dependent Methytransferase (Koonin for MG ortholog) | cell division protein FtsZ | ribonucleotide-diphosphate reductase subunit beta | permease | abc transport ATP-binding protein | small GTPase ERA involved in regulating metabolism and cell division | predicted metalloenzyme interacting with hemolysin | UDP-glucose pyrophosphorylase |
32 | 30 | 126 | -8.508 | ![htmls/cluster0032_profile.png](htmls/cluster0032_profile.png) Residual = 0.515 | ![htmls/cluster0032_network.png](htmls/cluster0032_network.png) | ![htmls/cluster0032_pssm1.png](htmls/cluster0032_pssm1.png) GnnAAgCgttgTCAtttTTaGCT | ![htmls/cluster0032_pssm2.png](htmls/cluster0032_pssm2.png) GtGcTAAtCCtcTTtGc | ![htmls/cluster0032_mot_posns.png](htmls/cluster0032_mot_posns.png) | MPN060 MPN155 MPN156 MPN160 MPN192 MPN207 MPN295 MPN296 MPN297 MPN298 MPN378 MPN419 MPN445 MPN448 MPN462 MPN469 MPN471 MPN483 MPN537 MPN563 MPN566 MPN567 MPN571 MPN619 MPN672 MPN673 MPN677 MPN678 MPN680 MPN686 | metX infB rbfA rplQ ptsG rpsU acpS dnaE lip3 rpmG yibD mucB obgE glpQ P200 lcnDR3 uvrA hpt gltX dnaA | S-adenosylmethionine synthetase | translation initiation factor IF-2 | ribosome binding factor A | hypothetical protein | 50S ribosomal protein L17 | PTS system, glucose-specific IIABC component | 30S ribosomal protein S21 | 4'-phosphopantetheinyl transferase | DNA polymerase III alpha subunit | triacylglycerol lipase (lip) 3 | 50S ribosomal protein L33 | bifunctional threonine dehydrogenase; galactosyltransferase | UV protection protein MucB | GTPase ObgE | Glpq or Uplq glycerophosphoryl diester phosphodiesterase | similar to cyto adherence proteins | similar to hemolysin ABC-type exporter | excinuclease ABC subunit A | hypoxanthine-guanine phosphoribosyltransferase | similar to ATPase | glutamyl-tRNA synthetase | putative inner membrane protein translocase component YidC | chromosomal replication initiation protein |
33 | 39 | 127 | -9.181 | ![htmls/cluster0033_profile.png](htmls/cluster0033_profile.png) Residual = 0.591 | ![htmls/cluster0033_network.png](htmls/cluster0033_network.png) | ![htmls/cluster0033_pssm1.png](htmls/cluster0033_pssm1.png) CCCCCTACACGCCCTtTACGgcac | ![htmls/cluster0033_pssm2.png](htmls/cluster0033_pssm2.png) gGGgGcTGGAtgTgG | ![htmls/cluster0033_mot_posns.png](htmls/cluster0033_mot_posns.png) | MPN035 MPN061 MPN068 MPN083 MPN091 MPN123 MPN142 MPN143 MPN147 MPN203 MPN235 MPN307 MPN308 MPN355 MPN356 MPN362 MPN366 MPN367 MPN383 MPN384 MPN399 MPN413 MPN414 MPN442 MPN443 MPN463 MPN485 MPN503 MPN511 MPN565 MPN581 MPN590 MPN591 MPN651 MPN661 MPN680 MPN681 MPN683 MPN684 | ffh secE parC orf6 ung arcC yacO cysS S-adenosyl-methionine dependent yidA leuS deaD mtlA K05_orf499 rnpA devA | hypothetical protein | signal recognition particle protein | preprotein translocase subunit SecE | topoisomerase IV subunit A | involved in cytadherence | uracil-DNA glycosylase | carbamate kinase | aa_permeases | tRNA/rRNA methyltransferase | cysteinyl-tRNA synthetase | hemk family, similar to methyltransferase (S-adenosyl-methionine dependent) | HAD superfamily hydrolase/phosphatase | leucyl-tRNA synthetase | hypothetical protein, involved in cytadherence | species specific lipoprotein | RNA helicase, eIF4-A translation initiation factor | protein family involved in cytadherence | membrane export protein family | similar to mannitol-specific PRS EIIBC | putative inner membrane protein translocase component YidC | RNaseP C5 chain | ABC transporter subunit | conserved hypothetical protein, suggestion: membrane transporter component |
34 | 29 | 125 | -5.246 | ![htmls/cluster0034_profile.png](htmls/cluster0034_profile.png) Residual = 0.490 | ![htmls/cluster0034_network.png](htmls/cluster0034_network.png) | ![htmls/cluster0034_pssm1.png](htmls/cluster0034_pssm1.png) CCTTAGCAGGG | ![htmls/cluster0034_pssm2.png](htmls/cluster0034_pssm2.png) GGTTTGgCttt | ![htmls/cluster0034_mot_posns.png](htmls/cluster0034_mot_posns.png) | MPN006 MPN008 MPN009 MPN023 MPN026 MPN037 MPN056 MPN071 MPN072 MPN075 MPN078 MPN080 MPN081 MPN122 MPN194 MPN196 MPN198 MPN199 MPN222 MPN233 MPN319 MPN330 MPN351 MPN365 MPN441 MPN550 MPN559 MPN635 MPN657 | trmE yabD metS yyaF potB yabC yabF ywdF fruA glnQ parB hisP truA mte1 yacA gap1 | thymidylate kinase | tRNA modification GTPase TrmE | hydrolase | methionyl-tRNA synthetase | translation-associated GTPase | hypothetical protein | spermidine/putrescine transport system permease | hypothetical protein (yabC) homolog; similar to Swiss-Prot Accession Number P37544, from B. subtilis | similar to nucelotidyl transferase/polynicleotide cleavage | Glycosyl Transferase | fructose-permease IIBC component | Probably ABC transporter membrane protein subunit | glutamine transport ATP-binding protein | topoisomerase IV subunit B | cobalt transport ATP-binding protein | tRNA pseudouridine synthase A | adenine-specific methyltransferase EcoRI | similar to PP-loop superfamily ATPase/cell cycle protein MESJ homologues | excreted conserved protein | general amino acid permease GAP1 homolog; similar to Swiss-Prot Accession Number P19145, from S. cerevisiae | methyltransferase | Thiamin biosynthesis protein |
35 | 11 | 116 | -7.870 | ![htmls/cluster0035_profile.png](htmls/cluster0035_profile.png) Residual = 0.431 | ![htmls/cluster0035_network.png](htmls/cluster0035_network.png) | ![htmls/cluster0035_pssm1.png](htmls/cluster0035_pssm1.png) aGgAAnGCCAG | ![htmls/cluster0035_pssm2.png](htmls/cluster0035_pssm2.png) tGGAGC | ![htmls/cluster0035_mot_posns.png](htmls/cluster0035_mot_posns.png) | MPN055 MPN315 MPN316 MPN317 MPN325 MPN360 MPN659 MPN660 MPN663 MPN664 MPN665 | potA yabC ftsZ rplU rpmE trmD rpsP degV tuf | spermidine/putrescine transport ATP-binding prot | SAM-Dependent Methytransferase (Koonin for MG ortholog) | hypothetical protein | cell division protein FtsZ | 50S ribosomal protein L21 | 50S ribosomal protein L31 | tRNA (guanine-N1)-methyltransferase | 30S ribosomal protein S16 | elongation factor Tu |
36 | 15 | 122 | -23.092 | ![htmls/cluster0036_profile.png](htmls/cluster0036_profile.png) Residual = 0.478 | ![htmls/cluster0036_network.png](htmls/cluster0036_network.png) | ![htmls/cluster0036_pssm1.png](htmls/cluster0036_pssm1.png) TttataAGAAAGGAGgTATTgCTT | ![htmls/cluster0036_pssm2.png](htmls/cluster0036_pssm2.png) cTGCAAGTAGTAGTTTTcTcAACC | ![htmls/cluster0036_mot_posns.png](htmls/cluster0036_mot_posns.png) | MPN013 MPN014 MPN094 MPN100 MPN130 MPN137 MPN139 MPN214 MPN287 MPN368 MPN410 MPN420 MPN421 MPN524 MPN607 | dnaE glpQ pmsR | hypothetical protein | glycerophosphoryl diester phosphodiesterase | permease | methionine sulfoxide reductase A |
37 | 21 | 122 | -6.771 | ![htmls/cluster0037_profile.png](htmls/cluster0037_profile.png) Residual = 0.399 | ![htmls/cluster0037_network.png](htmls/cluster0037_network.png) | ![htmls/cluster0037_pssm1.png](htmls/cluster0037_pssm1.png) ACcCCtggaattGgc | ![htmls/cluster0037_pssm2.png](htmls/cluster0037_pssm2.png) CGCGTACCAG | ![htmls/cluster0037_mot_posns.png](htmls/cluster0037_mot_posns.png) | MPN022 MPN069 MPN093 MPN205 MPN220 MPN292 MPN370 MPN387 MPN422 MPN464 MPN488 MPN489 MPN560 MPN562 MPN564 MPN583 MPN598 MPN608 MPN618 MPN632 MPN655 | pip rpmG rplA yceC 5-METHYLAMINOMETHYL-2-THIOURIDYLATE arcA outB adh atpD phoU dnaX pyrH | proline iminopeptidase | 50S ribosomal protein L33 | involved in cytadherence | hypothetical protein | 50S ribosomal protein L1 | similar to RIBOSOMAL LARGE SUBUNIT PSEUDOURIDINE SYNTHASE D | TRNA (5-METHYLAMINOMETHYL-2-THIOURIDYLATE)-METHYLTRANSFERASE. | NifU-like protein | species specific lipoprotein | arginine deiminase | probable NH(3)-dependent NAD(+) synthetase | similar to NADP-dependent alcohol dehydrogenase | F0F1 ATP synthase subunit beta | phosphate transport system regulatory protein | gamma-like | uridylate kinase |
38 | 15 | 122 | -10.944 | ![htmls/cluster0038_profile.png](htmls/cluster0038_profile.png) Residual = 0.440 | ![htmls/cluster0038_network.png](htmls/cluster0038_network.png) | ![htmls/cluster0038_pssm1.png](htmls/cluster0038_pssm1.png) TTgaAaGCtTgtTTT | ![htmls/cluster0038_pssm2.png](htmls/cluster0038_pssm2.png) CCCCCTCACGgGTGAAAACCCCGG | ![htmls/cluster0038_mot_posns.png](htmls/cluster0038_mot_posns.png) | MPN101 MPN115 MPN116 MPN117 MPN205 MPN243 MPN276 MPN320 MPN321 MPN322 MPN323 MPN324 MPN326 MPN506 MPN632 | infC rpmI rplT vacB thyA dhfr nrdF nrdI nrdE ysxB pyrH | hypothetical protein | translation initiation factor IF-3 | 50S ribosomal protein L35 | 50S ribosomal protein L20 | 3'-5' exoribonuclease, RNase R | thymidylate synthase | dihydrofolate reductase | ribonucleotide-diphosphate reductase subunit beta | ribonucleotide reductase stimulatory protein | ribonucleotide-diphosphate reductase subunit alpha | uridylate kinase |
39 | 24 | 122 | -10.212 | ![htmls/cluster0039_profile.png](htmls/cluster0039_profile.png) Residual = 0.450 | ![htmls/cluster0039_network.png](htmls/cluster0039_network.png) | ![htmls/cluster0039_pssm1.png](htmls/cluster0039_pssm1.png) CCncAAaaAcagCCaCcaaCcA | ![htmls/cluster0039_pssm2.png](htmls/cluster0039_pssm2.png) AacCAAC | ![htmls/cluster0039_mot_posns.png](htmls/cluster0039_mot_posns.png) | MPN021 MPN022 MPN069 MPN269 MPN375 MPN422 MPN470 MPN488 MPN560 MPN562 MPN564 MPN583 MPN585 MPN594 MPN595 MPN598 MPN602 MPN603 MPN605 MPN608 MPN618 MPN655 MPN656 MPN670 | dnaJ pip rpmG ysr1 5-METHYLAMINOMETHYL-2-THIOURIDYLATE pepX arcA outB adh lacA atpD atpF atpE phoU dnaX rbgA | heat shock protein DnaJ | proline iminopeptidase | 50S ribosomal protein L33 | hypothetical protein | TRNA (5-METHYLAMINOMETHYL-2-THIOURIDYLATE)-METHYLTRANSFERASE. | X-Pro dipeptidase | NifU-like protein | arginine deiminase | probable NH(3)-dependent NAD(+) synthetase | similar to NADP-dependent alcohol dehydrogenase | ribose-5-phosphate isomerase B | F0F1 ATP synthase subunit beta | F0F1 ATP synthase subunit B | F0F1 ATP synthase subunit C | phosphate transport system regulatory protein | gamma-like | ribosomal biogenesis GTPase |
40 | 5 | 112 | -4.157 | ![htmls/cluster0040_profile.png](htmls/cluster0040_profile.png) Residual = 0.261 | ![htmls/cluster0040_network.png](htmls/cluster0040_network.png) | ![htmls/cluster0040_pssm1.png](htmls/cluster0040_pssm1.png)
| ![htmls/cluster0040_pssm2.png](htmls/cluster0040_pssm2.png)
| ![htmls/cluster0040_mot_posns.png](htmls/cluster0040_mot_posns.png) | MPN172 MPN173 MPN174 MPN175 MPN176 | rplP rpmC rpsQ rplN rplX | 50S ribosomal protein L16 | 50S ribosomal protein L29 | 30S ribosomal protein S17 | 50S ribosomal protein L14 | 50S ribosomal protein L24 |
41 | 18 | 118 | -8.576 | ![htmls/cluster0041_profile.png](htmls/cluster0041_profile.png) Residual = 0.460 | ![htmls/cluster0041_network.png](htmls/cluster0041_network.png) | ![htmls/cluster0041_pssm1.png](htmls/cluster0041_pssm1.png) TTtCTTatTTAAAA | ![htmls/cluster0041_pssm2.png](htmls/cluster0041_pssm2.png) GGGTTTTAtTG | ![htmls/cluster0041_mot_posns.png](htmls/cluster0041_mot_posns.png) | MPN044 MPN062 MPN063 MPN064 MPN134 MPN258 MPN259 MPN260 MPN281 MPN284 MPN288 MPN321 MPN323 MPN324 MPN506 MPN576 MPN609 MPN610 | tdk deoD deoC deoA ugpC yjcW ribose/galactose rbsC dhfr nrdI nrdE glyA pstB pstA | thymidine kinase | purine nucleoside phosphorylase | deoxyribose-phosphate aldolase | thymidine phosphorylase | sn-glycerol-3-phosphate transport system permease protein | sugar (ribose/galactose) ABC transporter ATP-binding subunit | sugar (ribose/galactose) ABC transporter permease subunit, but probably C-terminal | sugar (ribose/galactose) ABC transporter permease subunit | hypothetical protein | dihydrofolate reductase | ribonucleotide reductase stimulatory protein | ribonucleotide-diphosphate reductase subunit alpha | serine hydroxymethyltransferase | phosphate specific | Psta /Pstc-like ABC transporter; phosphate specific |
42 | 38 | 124 | -6.940 | ![htmls/cluster0042_profile.png](htmls/cluster0042_profile.png) Residual = 0.562 | ![htmls/cluster0042_network.png](htmls/cluster0042_network.png) | ![htmls/cluster0042_pssm1.png](htmls/cluster0042_pssm1.png) CAaCgCtGttAAgGtGGaTtT | ![htmls/cluster0042_pssm2.png](htmls/cluster0042_pssm2.png) AAAgCAGCCaC | ![htmls/cluster0042_mot_posns.png](htmls/cluster0042_mot_posns.png) | MPN021 MPN052 MPN129 MPN134 MPN136 MPN155 MPN156 MPN162 MPN204 MPN252 MPN253 MPN255 MPN258 MPN259 MPN260 MPN261 MPN272 MPN329 MPN387 MPN444 MPN467 MPN487 MPN489 MPN507 MPN532 MPN537 MPN594 MPN596 MPN597 MPN598 MPN599 MPN600 MPN601 MPN602 MPN604 MPN609 MPN610 MPN620 | dnaJ group 2 ugpC ugpE infB rbfA asnC pgsA yjcW ribose/galactose rbsC topA Koonin for MG homologue nifS hsdS licA mucB atpC atpD atpG atpA atpH atpF atpB pstB pstA | heat shock protein DnaJ | putative lipoprotein | adhesin P1 (group 2) homolog | sn-glycerol-3-phosphate transport system permease protein | translation initiation factor IF-2 | ribosome binding factor A | hypothetical protein | asparaginyl-tRNA synthetase | phosphatidylglycerophosphate synthase | sugar (ribose/galactose) ABC transporter ATP-binding subunit | sugar (ribose/galactose) ABC transporter permease subunit, but probably C-terminal | sugar (ribose/galactose) ABC transporter permease subunit | DNA topoisomerase I | Ferric uptake regulator (Koonin for MG homologue) | putative cysteine desulfurase | species specific lipoprotein | type I restriction enzyme ecokI specificity protein (hsdS) homolog | similar to choline kinase | UV protection protein MucB | F0F1 ATP synthase subunit epsilon | F0F1 ATP synthase subunit beta | F0F1 ATP synthase subunit gamma | F0F1 ATP synthase subunit alpha | F0F1 ATP synthase subunit delta | F0F1 ATP synthase subunit B | F0F1 ATP synthase subunit A | phosphate specific | Psta /Pstc-like ABC transporter; phosphate specific |
43 | 2 | 118 | -8.078 | ![htmls/cluster0043_profile.png](htmls/cluster0043_profile.png) Residual = 0.114 | ![htmls/cluster0043_network.png](htmls/cluster0043_network.png) | ![htmls/cluster0043_pssm1.png](htmls/cluster0043_pssm1.png)
| ![htmls/cluster0043_pssm2.png](htmls/cluster0043_pssm2.png)
| ![htmls/cluster0043_mot_posns.png](htmls/cluster0043_mot_posns.png) | MPN166 MPN167 | rplD rplW | 50S ribosomal protein L4 | 50S ribosomal protein L23 |
44 | 41 | 125 | -6.104 | ![htmls/cluster0044_profile.png](htmls/cluster0044_profile.png) Residual = 0.466 | ![htmls/cluster0044_network.png](htmls/cluster0044_network.png) | ![htmls/cluster0044_pssm1.png](htmls/cluster0044_pssm1.png) ATGgtGgAAaaGGaGGgcTTgGAA | ![htmls/cluster0044_pssm2.png](htmls/cluster0044_pssm2.png) TTAaGtcTtTTcGCgATTgaCA | ![htmls/cluster0044_mot_posns.png](htmls/cluster0044_mot_posns.png) | MPN015 MPN017 MPN024 MPN025 MPN034 MPN053 MPN056 MPN057 MPN073 MPN077 MPN078 MPN079 MPN104 MPN125 MPN151 MPN152 MPN194 MPN196 MPN211 MPN285 MPN342 MPN349 MPN364 MPN381 MPN439 MPN455 MPN507 MPN530 MPN541 MPN542 MPN543 MPN579 MPN617 MPN629 MPN630 MPN631 MPN634 MPN652 MPN658 MPN660 MPN682 | mtd1 rpoE tsr polC ptsH potB potI prs fruA fruK uvrC hisP truA uvrB prrB hsdM yidA ctaD hsdS rpsT fmt rplM tim yfiB tsf mtlD rplS rpsP rpmH | hypothetical protein | 5,10-methylene-tetrahydrofolate dehydrogenase | DNA-directed RNA polymerase subunit delta | fructose-bisphosphate aldolase | DNA polymerase III (dnaE) alpha chain | phosphocarrier protein HPr | spermidine/putrescine transport system permease | ribose-phosphate pyrophosphokinase | fructose-permease IIBC component | 1-phosphofructokinase | excinuclease ABC subunit C | cobalt transport ATP-binding protein | tRNA pseudouridine synthase A | excinuclease ABC subunit B | type I restriction enzyme ecokI specificity protein | type I restriction enzyme HsdM | HAD superfamily hydrolase/phosphatase | type I restriction enzyme ecokI specificity protein (hsdS) homolog | 30S ribosomal protein S20 | methionyl-tRNA formyltransferase | 50S ribosomal protein L13 | triosephosphate isomerase | elongation factor Ts | mannitol-1-phosphate 5-dehydrogenase | 50S ribosomal protein L19 | 30S ribosomal protein S16 | 50S ribosomal protein L34 |
45 | 19 | 119 | -6.529 | ![htmls/cluster0045_profile.png](htmls/cluster0045_profile.png) Residual = 0.456 | ![htmls/cluster0045_network.png](htmls/cluster0045_network.png) | ![htmls/cluster0045_pssm1.png](htmls/cluster0045_pssm1.png) GCACCcCGGC | ![htmls/cluster0045_pssm2.png](htmls/cluster0045_pssm2.png) ATGGgGTTAATcCc | ![htmls/cluster0045_mot_posns.png](htmls/cluster0045_mot_posns.png) | MPN008 MPN065 MPN066 MPN086 MPN087 MPN088 MPN223 MPN233 MPN278 MPN335 MPN347 MPN418 MPN440 MPN475 MPN496 MPN510 MPN584 MPN586 MPN613 | trmE cdd cpsG group2 yefE hsdR alaS engA ulaA | tRNA modification GTPase TrmE | cytidine deaminase | two functions are possible, as both enzyme are homologous to each other: phosphomannomutase or phosphoglucomutase | adhesin P1 (group2) homolog | hypothetical protein | HPr kinase/phosphorylase | excreted conserved protein | udp-galactopyranose mutase | Type I Restriction Enzyme (fragment) | alanyl-tRNA synthetase | GTP-binding protein EngA | ascorbate-specific PTS system enzyme IIC | membrane export protein family |
46 | 14 | 116 | -6.544 | ![htmls/cluster0046_profile.png](htmls/cluster0046_profile.png) Residual = 0.357 | ![htmls/cluster0046_network.png](htmls/cluster0046_network.png) | ![htmls/cluster0046_pssm1.png](htmls/cluster0046_pssm1.png) CAAAgCC | ![htmls/cluster0046_pssm2.png](htmls/cluster0046_pssm2.png) cGCCGC | ![htmls/cluster0046_mot_posns.png](htmls/cluster0046_mot_posns.png) | MPN176 MPN180 MPN181 MPN182 MPN183 MPN189 MPN190 MPN216 MPN217 MPN218 MPN229 MPN231 MPN515 MPN516 | rplX rplF rplR rpsE rplO rpsM rpsK amiD oppD oppF ssb rplI rpoC rpoB | 50S ribosomal protein L24 | 50S ribosomal protein L6 | 50S ribosomal protein L18 | 30S ribosomal protein S5 | 50S ribosomal protein L15 | 30S ribosomal protein S13 | 30S ribosomal protein S11 | oligopeptide transport system permease protein AmiD | oligopeptide transport ATP-binding protein OppD | but only N- and C-term; inbetween (500AA) seg and coil | single-stranded DNA binding protein | 50S ribosomal protein L9 | DNA-directed RNA polymerase subunit beta' | DNA-directed RNA polymerase subunit beta |
47 | 28 | 126 | -7.441 | ![htmls/cluster0047_profile.png](htmls/cluster0047_profile.png) Residual = 0.520 | ![htmls/cluster0047_network.png](htmls/cluster0047_network.png) | ![htmls/cluster0047_pssm1.png](htmls/cluster0047_pssm1.png) ccAAAaAAaccaAAnnnAaca | ![htmls/cluster0047_pssm2.png](htmls/cluster0047_pssm2.png) tTTTGACcAgCTg | ![htmls/cluster0047_mot_posns.png](htmls/cluster0047_mot_posns.png) | MPN015 MPN024 MPN028 MPN030 MPN096 MPN097 MPN108 MPN282 MPN285 MPN461 MPN541 MPN557 MPN558 MPN561 MPN570 MPN572 MPN573 MPN574 MPN592 MPN616 MPN617 MPN620 MPN628 MPN629 MPN650 MPN652 MPN654 MPN658 | rpoE trsB prrB ktrA rpsT gidA gidB udk groEL groES rpsI rplM pgm tim mtlD rplS | hypothetical protein | DNA-directed RNA polymerase subunit delta | sugar transferase | aa_permeases | type I restriction enzyme ecokI specificity protein | KtrA, K+ Na+ uptake | 30S ribosomal protein S20 | tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA | methyltransferase GidB | uridine kinase | leucyl aminopeptidase | chaperonin GroEL | co-chaperonin GroES | 30S ribosomal protein S9 | 50S ribosomal protein L13 | phosphoglyceromutase | triosephosphate isomerase | mannitol-1-phosphate 5-dehydrogenase | 50S ribosomal protein L19 |
48 | 4 | 111 | -6.227 | ![htmls/cluster0048_profile.png](htmls/cluster0048_profile.png) Residual = 0.170 | ![htmls/cluster0048_network.png](htmls/cluster0048_network.png) | ![htmls/cluster0048_pssm1.png](htmls/cluster0048_pssm1.png)
| ![htmls/cluster0048_pssm2.png](htmls/cluster0048_pssm2.png)
| ![htmls/cluster0048_mot_posns.png](htmls/cluster0048_mot_posns.png) | MPN170 MPN171 MPN172 MPN177 | rplV rpsC rplP rplE | 50S ribosomal protein L22 | 30S ribosomal protein S3 | 50S ribosomal protein L16 | 50S ribosomal protein L5 |
49 | 25 | 130 | -11.303 | ![htmls/cluster0049_profile.png](htmls/cluster0049_profile.png) Residual = 0.462 | ![htmls/cluster0049_network.png](htmls/cluster0049_network.png) | ![htmls/cluster0049_pssm1.png](htmls/cluster0049_pssm1.png) ACAGctAtTTGTGCtGtcCAgGTC | ![htmls/cluster0049_pssm2.png](htmls/cluster0049_pssm2.png) CggCtntGGaTTTGnTtACAACC | ![htmls/cluster0049_mot_posns.png](htmls/cluster0049_mot_posns.png) | MPN027 MPN034 MPN054 MPN071 MPN075 MPN080 MPN095 MPN096 MPN125 MPN211 MPN291 MPN293 MPN294 MPN336 MPN337 MPN341 MPN381 MPN437 MPN447 MPN520 MPN521 MPN522 MPN542 MPN544 MPN549 | polC yabC ywdF uvrC uvrB lspA nadD mutB1 yidA hmw1 ileS ygl3 | hypothetical protein | DNA polymerase III (dnaE) alpha chain | hypothetical protein (yabC) homolog; similar to Swiss-Prot Accession Number P37544, from B. subtilis | Glycosyl Transferase | Probably ABC transporter membrane protein subunit | aa_permeases | excinuclease ABC subunit C | excinuclease ABC subunit B | signal peptidase II | similar to intracellular protease | putative nicotinate-nucleotide adenylyltransferase | DNA helicase II (with Mycoplasma specific C-terminal domain) | HAD superfamily hydrolase/phosphatase | cytadherence accessory protein HMW1 | isoleucyl-tRNA synthetase | putative rRNA methylase | similar to methyltransferase | phosphodiesterase |
50 | 22 | 122 | -13.878 | ![htmls/cluster0050_profile.png](htmls/cluster0050_profile.png) Residual = 0.508 | ![htmls/cluster0050_network.png](htmls/cluster0050_network.png) | ![htmls/cluster0050_pssm1.png](htmls/cluster0050_pssm1.png) gcnAATttAaAtAaAaTTTaAnca | ![htmls/cluster0050_pssm2.png](htmls/cluster0050_pssm2.png) TGattAAAActGatGnCtTGG | ![htmls/cluster0050_mot_posns.png](htmls/cluster0050_mot_posns.png) | MPN036 MPN076 MPN077 MPN135 MPN276 MPN449 MPN455 MPN460 MPN461 MPN491 MPN545 MPN546 MPN548 MPN557 MPN558 MPN568 MPN569 MPN573 MPN627 MPN628 MPN629 MPN631 | uhpT ugpA orf8 ctaD ktrB ktrA rnc plsX gidA gidB spg groEL ptsI pgm tim tsf | hypothetical protein | sn-glycerol-3-phosphate transport system permease protein | Trk-type K+ transport systems, membrane components | KtrA, K+ Na+ uptake | membrane nuclease | ribonuclease III | fatty acid/phospholipid synthesis protein | pseudouridine synthase | tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA | methyltransferase GidB | small GTPase ERA involved in regulating metabolism and cell division | predicted metalloenzyme interacting with hemolysin | chaperonin GroEL | PEP-dependent HPr protein kinase phosphoryltransferase (Enzyme I) | phosphoglyceromutase | triosephosphate isomerase | elongation factor Ts |
51 | 21 | 118 | -18.320 | ![htmls/cluster0051_profile.png](htmls/cluster0051_profile.png) Residual = 0.519 | ![htmls/cluster0051_network.png](htmls/cluster0051_network.png) | ![htmls/cluster0051_pssm1.png](htmls/cluster0051_pssm1.png) AAGgTagTtgTTttggTataTtT | ![htmls/cluster0051_pssm2.png](htmls/cluster0051_pssm2.png) AAAAtCAgccCccAAAnTTgcAat | ![htmls/cluster0051_mot_posns.png](htmls/cluster0051_mot_posns.png) | MPN034 MPN043 MPN055 MPN057 MPN058 MPN076 MPN153 MPN325 MPN327 MPN389 MPN390 MPN391 MPN461 MPN616 MPN617 MPN621 MPN624 MPN631 MPN658 MPN659 MPN660 | polC glpF potA potI uhpT rplU rpmA lplA pdhD pdhC ktrA rpsI rplM rpmB tsf rplS trmD rpsP | DNA polymerase III (dnaE) alpha chain | glycerol uptake facilitator | spermidine/putrescine transport ATP-binding prot | spermidine/putrescine transport system permease | hypothetical protein | 50S ribosomal protein L21 | 50S ribosomal protein L27 | lipoate protein ligase | dihydrolipoamide dehydrogenase | branched-chain alpha-keto acid dehydrogenase subunit E2 | KtrA, K+ Na+ uptake | 30S ribosomal protein S9 | 50S ribosomal protein L13 | similar to metallo hydrolase | 50S ribosomal protein L28 | elongation factor Ts | 50S ribosomal protein L19 | tRNA (guanine-N1)-methyltransferase | 30S ribosomal protein S16 |
52 | 28 | 123 | -5.983 | ![htmls/cluster0052_profile.png](htmls/cluster0052_profile.png) Residual = 0.629 | ![htmls/cluster0052_network.png](htmls/cluster0052_network.png) | ![htmls/cluster0052_pssm1.png](htmls/cluster0052_pssm1.png) gAAtCGAACCc | ![htmls/cluster0052_pssm2.png](htmls/cluster0052_pssm2.png) TTTGCAgTTt | ![htmls/cluster0052_mot_posns.png](htmls/cluster0052_mot_posns.png) | MPN024 MPN025 MPN141 MPN153 MPN208 MPN212 MPN213 MPN219 MPN224 MPN225 MPN243 MPN288 MPN326 MPN342 MPN358 MPN359 MPN360 MPN388 MPN406 MPN436 MPN446 MPN448 MPN470 MPN471 MPN472 MPN525 MPN526 MPN682 | rpoE tsr P1 rpsB rplK lgt rpsL vacB ysxB hsdM rpmE rpsD pepX rpmG degV rpmH | DNA-directed RNA polymerase subunit delta | fructose-bisphosphate aldolase | ADP1_MYCPN adhesin P1 | hypothetical protein | 30S ribosomal protein S2 | 50S ribosomal protein L11 | prolipoprotein diacylglyceryl transferase | 30S ribosomal protein S12 | 3'-5' exoribonuclease, RNase R | type I restriction enzyme HsdM | 50S ribosomal protein L31 | acyl carrier protein | 30S ribosomal protein S4 | X-Pro dipeptidase | 50S ribosomal protein L33 | 50S ribosomal protein L34 |
53 | 28 | 121 | -12.669 | ![htmls/cluster0053_profile.png](htmls/cluster0053_profile.png) Residual = 0.556 | ![htmls/cluster0053_network.png](htmls/cluster0053_network.png) | ![htmls/cluster0053_pssm1.png](htmls/cluster0053_pssm1.png) CttttaaAGAAAGGAGGTATTGcT | ![htmls/cluster0053_pssm2.png](htmls/cluster0053_pssm2.png) TCAATTTAtTTAGTGaAagcACAA | ![htmls/cluster0053_mot_posns.png](htmls/cluster0053_mot_posns.png) | MPN013 MPN094 MPN100 MPN107 MPN130 MPN140 MPN152 MPN161 MPN188 MPN266 MPN277 MPN283 MPN290 MPN344 MPN346 MPN348 MPN397 MPN410 MPN411 MPN466 MPN504 MPN505 MPN579 MPN588 MPN638 MPN650 MPN653 MPN675 | orf4 rpmJ ygl1 lysS fragment spoT mtlF | hypothetical protein | DHH family phosphoesterase | 50S ribosomal protein L36 | similar to (oxido/arsenate) reductase | lysyl-tRNA synthetase | Type I Restriction Enzyme hsdR (fragment) | 5-formyl tetrahydrofolate cyclo-ligase | p)ppGpp 3'-pyrophosphohydrolase | specificity determining subunit for restriction enzyme belonging to the K family of S proteins | PTS system mannitol-specific component IIA (EIIA-MTL) |
54 | 11 | 115 | -10.763 | ![htmls/cluster0054_profile.png](htmls/cluster0054_profile.png) Residual = 0.315 | ![htmls/cluster0054_network.png](htmls/cluster0054_network.png) | ![htmls/cluster0054_pssm1.png](htmls/cluster0054_pssm1.png) ATTAaCATGC | ![htmls/cluster0054_pssm2.png](htmls/cluster0054_pssm2.png) CGTTtGtG | ![htmls/cluster0054_mot_posns.png](htmls/cluster0054_mot_posns.png) | MPN180 MPN181 MPN182 MPN191 MPN226 MPN227 MPN515 MPN516 MPN538 MPN539 MPN540 | rplF rplR rpsE rpoA rpsG fus rpoC rpoB rplJ rplL rpmF | 50S ribosomal protein L6 | 50S ribosomal protein L18 | 30S ribosomal protein S5 | DNA-directed RNA polymerase subunit alpha | 30S ribosomal protein S7 | elongation factor G | DNA-directed RNA polymerase subunit beta' | DNA-directed RNA polymerase subunit beta | 50S ribosomal protein L10 | 50S ribosomal protein L7/L12 | 50S ribosomal protein L32 |
55 | 29 | 126 | -6.457 | ![htmls/cluster0055_profile.png](htmls/cluster0055_profile.png) Residual = 0.538 | ![htmls/cluster0055_network.png](htmls/cluster0055_network.png) | ![htmls/cluster0055_pssm1.png](htmls/cluster0055_pssm1.png) CacgCTTAtTnGcaT | ![htmls/cluster0055_pssm2.png](htmls/cluster0055_pssm2.png) GcttTACCcCc | ![htmls/cluster0055_mot_posns.png](htmls/cluster0055_mot_posns.png) | MPN005 MPN010 MPN019 MPN031 MPN068 MPN074 MPN266 MPN267 MPN268 MPN269 MPN277 MPN332 MPN428 MPN429 MPN430 MPN434 MPN476 MPN477 MPN478 MPN518 MPN520 MPN549 MPN554 MPN555 MPN605 MPN606 MPN642 MPN643 MPN644 | serS msbA secE smpB ygl1 ppnK ysr1 lysS lon eutD pgk gap dnaK cmk ileS eno | seryl-tRNA synthetase | hypothetical protein | transport ATP-binding protein | preprotein translocase subunit SecE | SsrA-binding protein | similar to (oxido/arsenate) reductase | inorganic polyphosphate/ATP-NAD kinase | similar to PTS system: EIIB and N-term part of EIIC; bidomainal | lysyl-tRNA synthetase | ATP-dependent protease Lon | phosphotransacetylase | phosphoglycerate kinase | glyceraldehyde-3-phosphate dehydrogenase | molecular chaperone DnaK | cytidylate kinase | isoleucyl-tRNA synthetase | phosphodiesterase | phosphopyruvate hydratase |
56 | 25 | 123 | -8.446 | ![htmls/cluster0056_profile.png](htmls/cluster0056_profile.png) Residual = 0.491 | ![htmls/cluster0056_network.png](htmls/cluster0056_network.png) | ![htmls/cluster0056_pssm1.png](htmls/cluster0056_pssm1.png) TAAACccGAAATTTCAATTAcTTT | ![htmls/cluster0056_pssm2.png](htmls/cluster0056_pssm2.png) TGTaAAGAAAGGAGtTaTTGC | ![htmls/cluster0056_mot_posns.png](htmls/cluster0056_mot_posns.png) | MPN085 MPN089 MPN109 MPN110 MPN127 MPN139 MPN221 MPN242 MPN246 MPN247 MPN271 MPN283 MPN343 MPN346 MPN374 MPN377 MPN382 MPN465 MPN484 MPN508 MPN528 MPN531 MPN534 MPN648 MPN675 | group2 hsdS pth secG gmk ptc1 fragment ppa clpB | adhesin P1 (group2) homolog | hypothetical protein | C09_orf165 Protein | peptidyl-tRNA hydrolase | preprotein translocase subunit SecG | membrane-associated guanylate kinase homologue | protein phoshatase 2C homolog; similar to Swiss-Prot Accession Number P35182, from S. cerevisiae | Type I Restriction Enzyme hsdR (fragment) | membrane export protein family | inorganic pyrophosphatase | ATP-dependent protease binding subunit ClpB | conserved hypothetical, RNA-expressed |
57 | 39 | 127 | -4.752 | ![htmls/cluster0057_profile.png](htmls/cluster0057_profile.png) Residual = 0.594 | ![htmls/cluster0057_network.png](htmls/cluster0057_network.png) | ![htmls/cluster0057_pssm1.png](htmls/cluster0057_pssm1.png) aTTTTgGTtGcttTT | ![htmls/cluster0057_pssm2.png](htmls/cluster0057_pssm2.png) AAAtGAGGtCTT | ![htmls/cluster0057_mot_posns.png](htmls/cluster0057_mot_posns.png) | MPN038 MPN039 MPN041 MPN052 MPN053 MPN090 MPN097 MPN111 MPN129 MPN146 MPN147 MPN151 MPN258 MPN265 MPN272 MPN281 MPN282 MPN313 MPN349 MPN359 MPN386 MPN388 MPN526 MPN532 MPN533 MPN588 MPN593 MPN596 MPN597 MPN599 MPN600 MPN601 MPN602 MPN603 MPN604 MPN627 MPN628 MPN629 MPN630 | ptsH group2 group 2 yjcW trpS yaaF licA ackA atpC atpG atpA atpH atpF atpE atpB ptsI pgm tim yfiB | hypothetical protein | putative lipoprotein | phosphocarrier protein HPr | adhesin P1 (group2) homolog | adhesin P1 (group 2) homolog | sugar (ribose/galactose) ABC transporter ATP-binding subunit | tryptophanyl-tRNA synthetase | DEOXYGUANOSINE KINASE/ DEOXYADENOSINE KINASE | similar to choline kinase | acetate kinase | F0F1 ATP synthase subunit epsilon | F0F1 ATP synthase subunit gamma | F0F1 ATP synthase subunit alpha | F0F1 ATP synthase subunit delta | F0F1 ATP synthase subunit B | F0F1 ATP synthase subunit C | F0F1 ATP synthase subunit A | PEP-dependent HPr protein kinase phosphoryltransferase (Enzyme I) | phosphoglyceromutase | triosephosphate isomerase |
58 | 44 | 130 | -5.368 | ![htmls/cluster0058_profile.png](htmls/cluster0058_profile.png) Residual = 0.562 | ![htmls/cluster0058_network.png](htmls/cluster0058_network.png) | ![htmls/cluster0058_pssm1.png](htmls/cluster0058_pssm1.png) TGGTtTTacnnTTccattAGCtTT | ![htmls/cluster0058_pssm2.png](htmls/cluster0058_pssm2.png) CaAGcGCcggAaGGGgacGGGTTG | ![htmls/cluster0058_mot_posns.png](htmls/cluster0058_mot_posns.png) | MPN008 MPN026 MPN027 MPN033 MPN035 MPN037 MPN047 MPN056 MPN071 MPN072 MPN073 MPN080 MPN086 MPN106 MPN196 MPN201 MPN202 MPN265 MPN274 MPN289 MPN301 MPN306 MPN330 MPN334 MPN345 MPN347 MPN351 MPN372 MPN402 MPN406 MPN435 MPN451 MPN483 MPN559 MPN563 MPN575 MPN582 MPN612 MPN614 MPN633 MPN635 MPN649 MPN669 MPN676 | trmE yyaF upp potB yabC yabF prs group2 pheT truA trpS A65_orf266 hsdS1B scpB argI bcrA hsdR proS come3 yibD obgE tyrS K05_orf106 | tRNA modification GTPase TrmE | translation-associated GTPase | hypothetical protein | uracil phosphoribosyltransferase | spermidine/putrescine transport system permease | hypothetical protein (yabC) homolog; similar to Swiss-Prot Accession Number P37544, from B. subtilis | similar to nucelotidyl transferase/polynicleotide cleavage | ribose-phosphate pyrophosphokinase | Probably ABC transporter membrane protein subunit | adhesin P1 (group2) homolog | phenylalanyl-tRNA synthetase subunit beta | tRNA pseudouridine synthase A | tryptophanyl-tRNA synthetase | ABC transporter (sulfate/molybdenum) permease subunit | this protein specifications means only that it is a type I restriction with enzyme ecokI specificity protein | segregation and condensation protein B | less (fragment) | ABC transporter ATP-binding protein | Type I Restriction Enzyme (fragment) | methyltransferase | similarity to pertussis toxin subunit s1 | prolyl-tRNA synthetase | acyl carrier protein | permease | competence locus operon protein 3 homolog; similar to Swiss-Prot Accession Number P39695, from B. subtilis | bifunctional threonine dehydrogenase; galactosyltransferase | GTPase ObgE | tyrosyl tRNA synthetase |
59 | 20 | 122 | -4.434 | ![htmls/cluster0059_profile.png](htmls/cluster0059_profile.png) Residual = 0.494 | ![htmls/cluster0059_network.png](htmls/cluster0059_network.png) | ![htmls/cluster0059_pssm1.png](htmls/cluster0059_pssm1.png) CancTCcaCCA | ![htmls/cluster0059_pssm2.png](htmls/cluster0059_pssm2.png) CCCCGgC | ![htmls/cluster0059_mot_posns.png](htmls/cluster0059_mot_posns.png) | MPN017 MPN046 MPN115 MPN116 MPN117 MPN136 MPN157 MPN174 MPN186 MPN187 MPN208 MPN209 MPN210 MPN230 MPN255 MPN256 MPN279 MPN280 MPN326 MPN338 | mtd1 aspS infC rpmI rplT ugpE rpsQ map infA rpsB mgtA secA rpsR lepA DNA ysxB | 5,10-methylene-tetrahydrofolate dehydrogenase | aspartyl-tRNA synthetase | translation initiation factor IF-3 | 50S ribosomal protein L35 | 50S ribosomal protein L20 | sn-glycerol-3-phosphate transport system permease protein | hypothetical protein | 30S ribosomal protein S17 | methionine amino peptidase | initiation factor 1 | 30S ribosomal protein S2 | cation-transporting P-type ATPase | preprotein translocase subunit SecA | 30S ribosomal protein S18 | GTP-binding protein LepA | similar to single stranded RNA(DNA) processing enzyme |
60 | 16 | 121 | -9.925 | ![htmls/cluster0060_profile.png](htmls/cluster0060_profile.png) Residual = 0.421 | ![htmls/cluster0060_network.png](htmls/cluster0060_network.png) | ![htmls/cluster0060_pssm1.png](htmls/cluster0060_pssm1.png) CACCcCGCctaCgaTcAGg | ![htmls/cluster0060_pssm2.png](htmls/cluster0060_pssm2.png) gGGAATAAcnCCAtA | ![htmls/cluster0060_mot_posns.png](htmls/cluster0060_mot_posns.png) | MPN065 MPN066 MPN086 MPN087 MPN092 MPN201 MPN202 MPN249 MPN278 MPN418 MPN510 MPN580 MPN584 MPN613 MPN677 MPN679 | cdd cpsG group2 yjeQ yefE alaS ksgA | cytidine deaminase | two functions are possible, as both enzyme are homologous to each other: phosphomannomutase or phosphoglucomutase | adhesin P1 (group2) homolog | involved in cytadherence | hypothetical protein | conserved hypothetical protein, 154-190 similar to GTP/ATP binding proteins | udp-galactopyranose mutase | alanyl-tRNA synthetase | membrane export protein family | similar to ATPase | dimethyladenosine transferase |
61 | 26 | 119 | -2.265 | ![htmls/cluster0061_profile.png](htmls/cluster0061_profile.png) Residual = 0.504 | ![htmls/cluster0061_network.png](htmls/cluster0061_network.png) | ![htmls/cluster0061_pssm1.png](htmls/cluster0061_pssm1.png) GcTTTAAa | ![htmls/cluster0061_pssm2.png](htmls/cluster0061_pssm2.png) CAgCAACTtCA | ![htmls/cluster0061_mot_posns.png](htmls/cluster0061_mot_posns.png) | MPN054 MPN088 MPN089 MPN110 MPN306 MPN334 MPN343 MPN350 MPN374 MPN407 MPN415 MPN416 MPN423 MPN508 MPN531 MPN534 MPN544 MPN614 MPN640 MPN641 MPN645 MPN646 MPN647 MPN648 MPN687 MPN688 | hsdS argI bcrA ygiH P37 P29 clpB soj | hypothetical protein | less (fragment) | ABC transporter ATP-binding protein | lipase | high affinity transport system protein P37 | ATP-binding protein P29 | membrane export protein family | ATP-dependent protease binding subunit ClpB | conserved hypothetical, RNA-expressed | ParA family of ATPase involved in chromosome partition |
62 | 36 | 125 | -5.865 | ![htmls/cluster0062_profile.png](htmls/cluster0062_profile.png) Residual = 0.568 | ![htmls/cluster0062_network.png](htmls/cluster0062_network.png) | ![htmls/cluster0062_pssm1.png](htmls/cluster0062_pssm1.png) CcccGTTGGCAGCAgTGCTgCAAG | ![htmls/cluster0062_pssm2.png](htmls/cluster0062_pssm2.png) TtgcTnnttTTAaananTTnt | ![htmls/cluster0062_mot_posns.png](htmls/cluster0062_mot_posns.png) | MPN001 MPN002 MPN084 MPN124 MPN145 MPN163 MPN200 MPN221 MPN235 MPN239 MPN241 MPN273 MPN274 MPN275 MPN283 MPN318 MPN348 MPN353 MPN354 MPN383 MPN385 MPN398 MPN399 MPN400 MPN407 MPN417 MPN474 MPN482 MPN518 MPN523 MPN524 MPN527 MPN565 MPN611 MPN615 MPN688 | dnaN xdj1 hrcA pth ung hit1 A65_orf266 yaaK dnaE grs1 yidA P69 hsdS soj | DNA polymerase III beta subunit | similar to j-domain of DnaJ | hypothetical protein | heat-inducible transcription repressor | peptidyl-tRNA hydrolase | uracil-DNA glycosylase | nucleotidyl hydrolase/transferase | ABC transporter (sulfate/molybdenum) permease subunit | amino acid permease | 5-formyl tetrahydrofolate cyclo-ligase | DNA primase | glycyl-tRNA synthetase | HAD superfamily hydrolase/phosphatase | lipase | transport system permease protein P69 | coiled coil protein, putative structural protein involved in cytosceleton | probably membrane component, similar to STARP antigen | putative membrane integrated oxidoreductase | similar to phosphate binding protein Psts | ParA family of ATPase involved in chromosome partition |
63 | 45 | 121 | -8.036 | ![htmls/cluster0063_profile.png](htmls/cluster0063_profile.png) Residual = 0.479 | ![htmls/cluster0063_network.png](htmls/cluster0063_network.png) | ![htmls/cluster0063_pssm1.png](htmls/cluster0063_pssm1.png) CGCTTGGTGGAggGGA | ![htmls/cluster0063_pssm2.png](htmls/cluster0063_pssm2.png) CcTCaAgGaAAGCC | ![htmls/cluster0063_mot_posns.png](htmls/cluster0063_mot_posns.png) | MPN067 MPN108 MPN157 MPN158 MPN173 MPN177 MPN178 MPN179 MPN180 MPN181 MPN182 MPN184 MPN185 MPN193 MPN195 MPN196 MPN225 MPN226 MPN227 MPN228 MPN229 MPN238 MPN256 MPN257 MPN261 MPN310 MPN311 MPN312 MPN327 MPN328 MPN329 MPN340 MPN351 MPN352 MPN357 MPN361 MPN487 MPN581 MPN633 MPN634 MPN657 MPN658 MPN663 MPN671 MPN681 | nusG yaaC rpmC rplE rpsN rpsH rplF rplR rpsE secY adk CbiO truA rpsL rpsG fus rpsF ssb gatB galE topA SwissProt HMW2_MYCPN rpmA nfo Koonin for MG homologue pcrA sigA lig prfA nifS rplS ftsH rnpA | transcription antitermination factor | hypothetical protein | riboflavin kinase (flavokinase)/FMN adenylyltransferase (FAD pyrophosphorylase) (FAD synthetase); bifunctional | 50S ribosomal protein L29 | 50S ribosomal protein L5 | 30S ribosomal protein S14 | 30S ribosomal protein S8 | 50S ribosomal protein L6 | 50S ribosomal protein L18 | 30S ribosomal protein S5 | preprotein translocase subunit SecY | adenylate kinase | cobalt transport ATP-binding protein | similar to cobalt transport membrane protein | tRNA pseudouridine synthase A | 30S ribosomal protein S12 | 30S ribosomal protein S7 | elongation factor G | 30S ribosomal protein S6 | single-stranded DNA binding protein | aspartyl/glutamyl-tRNA amidotransferase subunit B | UDP-glucose 4-epimerase | DNA topoisomerase I | Cytadherence High Molecular Weight Protein 2 (SwissProt HMW2_MYCPN) | 50S ribosomal protein L27 | endonuclease IV | Ferric uptake regulator (Koonin for MG homologue) | DNA helicase II | methyltransferase | RNA polymerase sigma factor RpoD | DNA ligase | peptide chain release factor 1 | putative cysteine desulfurase | 50S ribosomal protein L19 | cell division protein FtsH | RNaseP C5 chain |
64 | 14 | 117 | -9.518 | ![htmls/cluster0064_profile.png](htmls/cluster0064_profile.png) Residual = 0.424 | ![htmls/cluster0064_network.png](htmls/cluster0064_network.png) | ![htmls/cluster0064_pssm1.png](htmls/cluster0064_pssm1.png) TGGTcGAaGtG | ![htmls/cluster0064_pssm2.png](htmls/cluster0064_pssm2.png) CAGTTC | ![htmls/cluster0064_mot_posns.png](htmls/cluster0064_mot_posns.png) | MPN079 MPN179 MPN184 MPN185 MPN190 MPN191 MPN195 MPN197 MPN236 MPN237 MPN238 MPN338 MPN339 MPN340 | fruK rpsH secY adk rpsK rpoA pepF gatA gatB pcrA | 1-phosphofructokinase | 30S ribosomal protein S8 | preprotein translocase subunit SecY | adenylate kinase | 30S ribosomal protein S11 | DNA-directed RNA polymerase subunit alpha | similar to cobalt transport membrane protein | oligoendopeptidase F | aspartyl/glutamyl-tRNA amidotransferase subunit C-like protein | aspartyl/glutamyl-tRNA amidotransferase subunit A | aspartyl/glutamyl-tRNA amidotransferase subunit B | hypothetical protein | DNA helicase II |
65 | 24 | 119 | -7.199 | ![htmls/cluster0065_profile.png](htmls/cluster0065_profile.png) Residual = 0.487 | ![htmls/cluster0065_network.png](htmls/cluster0065_network.png) | ![htmls/cluster0065_pssm1.png](htmls/cluster0065_pssm1.png) GCACnGCGGCA | ![htmls/cluster0065_pssm2.png](htmls/cluster0065_pssm2.png) GcTnanCTTtgaGCg | ![htmls/cluster0065_mot_posns.png](htmls/cluster0065_mot_posns.png) | MPN045 MPN113 MPN114 MPN150 MPN159 MPN305 MPN306 MPN307 MPN308 MPN333 MPN355 MPN368 MPN373 MPN404 MPN405 MPN412 MPN437 MPN441 MPN445 MPN492 MPN493 MPN494 MPN590 MPN591 | hisS cpt2 hlyC arcA argI arcC F10_orf750 yacO lip3 yjfW ulaD yjfU | histidyl-tRNA synthetase | Similarity to G3P transporters | Acyltransferase | hypothetical protein | tlyC homolog, hemolysin activity doubtful | (C-terminal, fragment) | less (fragment) | carbamate kinase | aa_permeases | tRNA/rRNA methyltransferase | triacylglycerol lipase (lip) 3 | L-xylulose 5-phosphate 3-epimerase | 3-keto-L-gulonate-6-phosphate decarboxylase | similar to phosphotransferase protein II, component A, for pentitol, SGAT homolog |
66 | 29 | 122 | -11.278 | ![htmls/cluster0066_profile.png](htmls/cluster0066_profile.png) Residual = 0.560 | ![htmls/cluster0066_network.png](htmls/cluster0066_network.png) | ![htmls/cluster0066_pssm1.png](htmls/cluster0066_pssm1.png) CaCcCtcaCCCcttacaaccCCG | ![htmls/cluster0066_pssm2.png](htmls/cluster0066_pssm2.png) GGGGGcaGGaTGttG | ![htmls/cluster0066_mot_posns.png](htmls/cluster0066_mot_posns.png) | MPN006 MPN007 MPN059 MPN060 MPN091 MPN099 MPN101 MPN141 MPN142 MPN184 MPN196 MPN203 MPN328 MPN362 MPN366 MPN367 MPN372 MPN395 MPN402 MPN413 MPN414 MPN442 MPN443 MPN444 MPN462 MPN468 MPN485 MPN500 MPN502 | holB gcp metX P1 orf6 secY truA nfo S-adenosyl-methionine dependent apt proS deaD | thymidylate kinase | DNA polymerase III subunit delta' | O-sialoglycoprotein endopeptidase | S-adenosylmethionine synthetase | hypothetical protein | ADP1_MYCPN adhesin P1 | involved in cytadherence | preprotein translocase subunit SecY | tRNA pseudouridine synthase A | endonuclease IV | hemk family, similar to methyltransferase (S-adenosyl-methionine dependent) | similarity to pertussis toxin subunit s1 | adenine phosphoribosyltransferase | prolyl-tRNA synthetase | hypothetical protein, involved in cytadherence | species specific lipoprotein | RNA helicase, eIF4-A translation initiation factor |
67 | 35 | 127 | -4.739 | ![htmls/cluster0067_profile.png](htmls/cluster0067_profile.png) Residual = 0.507 | ![htmls/cluster0067_network.png](htmls/cluster0067_network.png) | ![htmls/cluster0067_pssm1.png](htmls/cluster0067_pssm1.png) cCGCtAaCcaA | ![htmls/cluster0067_pssm2.png](htmls/cluster0067_pssm2.png) GGCTtagGTnGaaG | ![htmls/cluster0067_mot_posns.png](htmls/cluster0067_mot_posns.png) | MPN020 MPN095 MPN121 MPN178 MPN198 MPN248 MPN263 MPN264 MPN290 MPN294 MPN295 MPN296 MPN300 MPN301 MPN396 MPN401 MPN419 MPN446 MPN484 MPN497 MPN533 MPN566 MPN567 MPN571 MPN582 MPN661 MPN662 MPN669 MPN672 MPN673 MPN677 MPN678 MPN679 MPN680 MPN683 | yb95 rpsN mte1 trx rpsU scpA scpB F11_orf887 greA rpsD ackA glpQ P200 lcnDR3 K05_orf499 pilB tyrS hpt gltX ksgA devA | similar to helicases | aa_permeases | hypothetical protein | 30S ribosomal protein S14 | adenine-specific methyltransferase EcoRI | Ser/Thr/Tyr protein kinase | thioredoxin | 150-end, similar to phosphate hydrolising | similar to intracellular protease | 30S ribosomal protein S21 | segregation and condensation protein A/unknown domain fusion protein | segregation and condensation protein B | protein export, secD like | transcription elongation factor GreA | 30S ribosomal protein S4 | similar to PHOSPHOTRIESTERASE HOMOLOGY PROTEIN | acetate kinase | Glpq or Uplq glycerophosphoryl diester phosphodiesterase | similar to cyto adherence proteins | similar to hemolysin ABC-type exporter | methionine sulfoxide reductase B | tyrosyl tRNA synthetase | hypoxanthine-guanine phosphoribosyltransferase | similar to ATPase | glutamyl-tRNA synthetase | dimethyladenosine transferase | putative inner membrane protein translocase component YidC | ABC transporter subunit |
68 | 27 | 122 | -10.767 | ![htmls/cluster0068_profile.png](htmls/cluster0068_profile.png) Residual = 0.475 | ![htmls/cluster0068_network.png](htmls/cluster0068_network.png) | ![htmls/cluster0068_pssm1.png](htmls/cluster0068_pssm1.png) CTacAtCCAttTGaGCTaTgctgG | ![htmls/cluster0068_pssm2.png](htmls/cluster0068_pssm2.png) CagGATTATTtTAGTTaGaaTTAA | ![htmls/cluster0068_mot_posns.png](htmls/cluster0068_mot_posns.png) | MPN003 MPN004 MPN023 MPN081 MPN122 MPN123 MPN262 MPN270 MPN312 MPN336 MPN339 MPN340 MPN341 MPN353 MPN379 MPN424 MPN425 MPN426 MPN519 MPN545 MPN546 MPN547 MPN550 MPN551 MPN552 MPN553 MPN637 | gyrB gyrA metS glnQ parB parC A65_orf475 nadD pcrA mutB1 dnaE polA ylxM ftsY lip3 rnc plsX thrSv cdsA | DNA gyrase subunit B | DNA gyrase subunit A | methionyl-tRNA synthetase | glutamine transport ATP-binding protein | topoisomerase IV subunit B | topoisomerase IV subunit A | conserved hypothetical protein, similar to reticulocyte binding protein | hypothetical protein | putative nicotinate-nucleotide adenylyltransferase | DNA helicase II | DNA helicase II (with Mycoplasma specific C-terminal domain) | DNA primase | 5'-3' exonuclease (complete) | cell division protein FtsY | SMC family, chromosome/DNA binding/protecting functions | triacylglycerol lipase (lip) 3 | ribonuclease III | fatty acid/phospholipid synthesis protein | dihydroacetone kinase | Thiamin biosynthesis protein | threonyl-tRNA synthetase | CDP-diglyceride synthetase |
69 | 14 | 117 | -9.912 | ![htmls/cluster0069_profile.png](htmls/cluster0069_profile.png) Residual = 0.455 | ![htmls/cluster0069_network.png](htmls/cluster0069_network.png) | ![htmls/cluster0069_pssm1.png](htmls/cluster0069_pssm1.png) cTaATTTTgCA | ![htmls/cluster0069_pssm2.png](htmls/cluster0069_pssm2.png) AgATaAaGCTgTAGaGAGG | ![htmls/cluster0069_mot_posns.png](htmls/cluster0069_mot_posns.png) | MPN044 MPN062 MPN063 MPN064 MPN146 MPN213 MPN284 MPN320 MPN455 MPN576 MPN629 MPN665 MPN666 MPN667 | tdk deoD deoC deoA thyA ctaD glyA tim tuf gtaB | thymidine kinase | purine nucleoside phosphorylase | deoxyribose-phosphate aldolase | thymidine phosphorylase | hypothetical protein | thymidylate synthase | serine hydroxymethyltransferase | triosephosphate isomerase | elongation factor Tu | UDP-glucose pyrophosphorylase |