| cluster | n.genes | n.arrays | score | hmm | profile | network | motif1 | motif2 | motif.posns | probe.names | short.names | long.names |
| 1 | 26 | 56 | -1.369 | | 
Residual = 0.827 |  | 
TttaTttAAgatAtcAagAgAAtA | 
GCTAATGTATAAGTAGCCAAAATC |  | MMP0132 MMP0136 MMP0171 MMP0240 MMP0348 MMP0407 MMP0416 MMP0456 MMP0496 MMP0519 MMP0602 MMP0603 MMP0998 MMP1022 MMP1043 MMP1049 MMP1221 MMP1222 MMP1289 MMP1310 MMP1376 MMP1539 MMP1562 MMP1583 MMP1633 MMP1704 | leuD xerD-like pyrF aIF-1A atpF radA rpl10e purO mtrC | branched-chain amino acid aminotransferase | 3-isopropylmalate dehydratase, small subunit | hypothetical protein | GPR1/FUN34/yaaH family protein | Phage integrase | glutamate synthase subunit-related | orotidine-5'-phosphate decarboxylase | translation initiation factor IF-1A | V-type ATP synthase subunit F | multiple resistance and pH regulation protein F | SAM-binding motif-containing protein | DNA repair and recombination protein RadA | 50S ribosomal protein L10e | IMP cyclohydrolase | phage shock protein C, PspC | tetrahydromethanopterin S-methyltransferase subunit C | S-adenosylmethionine decarboxylase related |
| 2 | 19 | 57 | -1.416 | | 
Residual = 0.629 |  | 
gCCTgGG | 
GCaAAAccgCAtACg |  | MMP0085 MMP0255 MMP0420 MMP0478 MMP0579 MMP0597 MMP0657 MMP0939 MMP0981 MMP1074 MMP1301 MMP1319 MMP1321 MMP1322 MMP1323 MMP1324 MMP1325 MMP1351 MMP1355 | flpA subfamily IA cdhD ehbD fdhC rps13p rps11p rpoD rpl13p rps9p | hypothetical protein | isoleucyl-tRNA synthetase related | CBS domain-containing protein | fibrillarin | HAD superfamily (subfamily IA) hydrolase | acetyl-CoA decarbonylase/synthase complex subunit delta | formate/nitrite transporter | 30S ribosomal protein S13P | 30S ribosomal protein S11P | DNA-directed RNA polymerase, subunit D | 50S ribosomal protein L18e | 50S ribosomal protein L13P | 30S ribosomal protein S9P | hexapeptide repeat-containing transferase |
| 3 | 6 | 59 | -3.414 | | 
Residual = 0.158 |  | 
ACGGgA | 
GaGGTG |  | MMP0017 MMP1044 MMP1045 MMP1563 MMP1564 MMP1566 | atpA atpB mtrB mtrA mtrG | hypothetical protein | V-type ATP synthase subunit A | V-type ATP synthase subunit B | tetrahydromethanopterin S-methyltransferase subunit B | tetrahydromethanopterin S-methyltransferase subunit A | tetrahydromethanopterin S-methyltransferase subunit G |
| 4 | 28 | 58 | -0.202 | | 
Residual = 0.949 |  | 
CCCCaa | 
GCTCcCcCTGA |  | MMP0208 MMP0281 MMP0296 MMP0437 MMP0438 MMP0449 MMP0473 MMP0504 MMP0522 MMP0659 MMP0670 MMP0728 MMP0775 MMP0778 MMP0795 MMP0805 MMP0861 MMP0864 MMP0876 MMP0975 MMP1150 MMP1239 MMP1272 MMP1341 MMP1381 MMP1522 MMP1525 MMP1678 | modC uvrC kamA napA-2 cofG modA mtaA vorB rad50 nfo | hypothetical protein | ATPase | ferredoxin | molybdenum ABC transporter ATP-binding protein | peptidase U32 | excinuclease ABC subunit C | lysine 2,3-aminomutase | Na+/H+ exchanger | FO synthase subunit 1 | molybdenum ABC transporter solute-binding protein | uroporphyrinogen decarboxylase | 2-ketoisovalerate ferredoxin reductase | SMC domain protein | Beta-lactamase-like protein | modulator of DNA gyrase | endonuclease IV |
| 5 | 25 | 58 | -0.584 | | 
Residual = 0.766 |  | 
TcGaGgGGGaC | 
TATATATAATT |  | MMP0075 MMP0191 MMP0192 MMP0446 MMP0459 MMP0481 MMP0486 MMP0502 MMP0506 MMP0507 MMP0512 MMP0513 MMP0514 MMP0520 MMP0691 MMP0766 MMP0777 MMP0781 MMP0787 MMP0791 MMP0797 MMP1027 MMP1086 MMP1130 MMP1690 | modB modA fmdB MoeA transporting resP | abortive infection protein | hypothetical protein | nitrogen fixation-related protein | NifC-like ABC-type porter | molybdenum ABC transporter periplasmic molybdate-binding protein | molybdenum containing formylmethanofuran dehydrogenase, subunit B | molybdopterin biosynthesis moeA protein | ATPase, P-type (transporting), HAD superfamily, subfamily IC | site-specific recombinase | MarR family transcriptional regulator | TetR family transcriptional regulator Member | general substrate transporter | hisA/hisF family protein |
| 6 | 17 | 56 | -2.346 | | 
Residual = 0.406 |  | 
TcATGATT | 
CTAACGGTGg |  | MMP0148 MMP0617 MMP0980 MMP1275 MMP1502 MMP1503 MMP1505 MMP1506 MMP1507 MMP1511 MMP1621 MMP1622 MMP1623 MMP1624 MMP1625 MMP1626 MMP1627 | acsA radB cdh porF porE porA porD porC ehbO ehbM ehbL ehbK ehbJ ehbG | acetyl-CoA synthetase, AMP-forming | DNA repair and recombination protein RadB | acetyl-CoA decarbonylase/synthase complex subunit gamma | hypothetical protein | pyruvate oxidoreductase-associated | pyruvate oxidoreductase (synthase) subunit alpha | pyruvate oxidoreductase (synthase) subunit delta | pyruvate ferredoxin oxidoreductase subunit gamma | amino acid carrier protein | energy conserving hydrogenase B integral membrane subunit | energy conserving hydrogenase B small subunit | ferredoxin | polyferredoxin | putative monovalent cation/H+ antiporter subunit B |
| 7 | 24 | 56 | -0.142 | | 
Residual = 0.778 |  | 
cGcCGtGGC | 
cAGGCGCaC |  | MMP0032 MMP0076 MMP0086 MMP0087 MMP0147 MMP0193 MMP0387 MMP0440 MMP0653 MMP0714 MMP0875 MMP0934 MMP0938 MMP0956 MMP0991 MMP1001 MMP1011 MMP1119 MMP1120 MMP1181 MMP1223 MMP1264 MMP1533 MMP1556 | tfx hmgA iorB2 slpB cobS topA gltX yjlA mcrD | transcription regulator ArsR | deoxyribonuclease | putative transcriptional regulator | hydroxymethylglutaryl-coenzyme A reductase:3-hydroxy-3-methylglutaryl coenzyme A reductase | nitrogenase reductase-like protein | hypothetical protein | microsomal signal peptidase 21 KD subunit | DNA-directed RNA polymerase subunit E' | bile acid:sodium symporter | indolepyruvate oxidoreductase subunit beta | S layer protein | cobalamin (5'-phosphate) synthase | DNA topoisomerase I | glutamyl-tRNA synthetase | ATPase-like ATP-binding protein | iron transport system binding protein | methyl-coenzyme M reductase I, protein D |
| 8 | 23 | 57 | -1.115 | | 
Residual = 0.634 |  | 
ataATnnAaaattAtatATtTaaA | 
GTTGCCATATAGAACGCATAGC |  | MMP0113 MMP0158 MMP0198 MMP0602 MMP0609 MMP0618 MMP0751 MMP0967 MMP0985 MMP1050 MMP1070 MMP1071 MMP1102 MMP1115 MMP1440 MMP1441 MMP1551 MMP1575 MMP1585 MMP1593 MMP1595 MMP1630 MMP1681 | III pyrF pth2 cdhA mobB ffh bioW | hypothetical protein | ABC-type iron(III) transport system, ATP binding protein | orotidine-5'-phosphate decarboxylase | peptidyl-tRNA hydrolase | acetyl-CoA decarbonylase/synthase complex subunit alpha | phospholipase D/transphosphatidylase | transketolase, N terminal half | tRNA-modifying enzyme | molybdopterin-guanine dinucleotide biosynthesis protein | signal recognition particle protein Srp54 | 6-carboxyhexanoate--CoA ligase | arginase | queuine/other tRNA-ribosyltransferase: | ABC transporter ATPase |
| 9 | 32 | 59 | 0.043 | | 
Residual = 0.756 |  | 
aATtcTGGTGA | 
ATcCCcCCnGA |  | MMP0001 MMP0151 MMP0184 MMP0214 MMP0215 MMP0222 MMP0236 MMP0247 MMP0248 MMP0389 MMP0400 MMP0562 MMP0592 MMP0630 MMP0912 MMP1073 MMP1099 MMP1182 MMP1311 MMP1338 MMP1374 MMP1400 MMP1401 MMP1402 MMP1428 MMP1435 MMP1465 MMP1469 MMP1586 MMP1620 MMP1708 RNA_43 | rpl40e ehbQ feoB ehbC rnhB ef1B secE ehaR ehbA rps27e tRNA-Trp | hypothetical protein | 50S ribosomal protein L40e | non-canonical purine NTP pyrophosphatase, rdgB/HAM1 family | ribosomal biogenesis protein | DNA-directed RNA polymerase related protein | ferredoxin | amino acid-binding ACT domain protein | ferrous iron transporter (GTP-binding) | 4-oxalocrotonate tautomerase | putative monovalent cation/H+ antiporter subunit G | phosphate transporter PhoU | transport system permease protein | ribonuclease HII | elongation factor 1-beta | preprotein translocase subunit SecE | putative monovalent cation/H+ antiporter subunit E | 30S ribosomal protein S27e | tRNA-Trp |
| 10 | 12 | 56 | -3.508 | | 
Residual = 0.604 |  | 
GGgGCGntC | 
GtttTaaGcGtATAaAA |  | MMP0145 MMP0596 MMP0617 MMP0880 MMP0893 MMP1399 MMP1403 MMP1404 MMP1417 MMP1420 MMP1497 MMP1547 | hpt NOP5/NOP56 radB aksF pyrG rpl22p rps3p rpl19e rpl30p rps19p | adenine phosphoribosyltransferase | RNA 2'-O-methyl modification protein (NOP5/NOP56) | DNA repair and recombination protein RadB | isopropylmalate/isohomocitrate dehydrogenase | CTP synthetase | aspartate/glutamate/uridylate kinase | 50S ribosomal protein L22P | 30S ribosomal protein S3P | 50S ribosomal protein L19e | 50S ribosomal protein L30P | hypothetical protein | 30S ribosomal protein S19P |
| 11 | 28 | 58 | -1.608 | | 
Residual = 0.860 |  | 
CCaaaATtTtCAtttTttCACCAA | 
GTGGGGG |  | MMP0038 MMP0055 MMP0235 MMP0238 MMP0278 MMP0313 MMP0321 MMP0436 MMP0526 MMP0600 MMP0622 MMP0629 MMP0692 MMP0693 MMP0723 MMP0847 MMP0851 MMP0923 MMP0949 MMP0959 MMP1001 MMP1055 MMP1079 MMP1166 MMP1221 MMP1490 MMP1613 MMP1689 | rimK dapB trxB ssh10b_1 comE | type II secretion system protein | hypothetical protein | putative signal transduction protein with CBS domains | RimK domain protein ATP-grasp | ADP-ribosylation/crystallin J1 | aminoacyl-tRNA synthetase, class II | dihydrodipicolinate reductase | tRNA CCA-pyrophosphorylase | FAD-dependent pyridine nucleotide-disulphide oxidoreductase | glycosyl transferase family protein | iron-sulfur flavoprotein | SAM-binding motif-containing protein | ATP/GTP-binding motif-containing protein | DNA/RNA-binding protein albA | sulfopyruvate decarboxylase subunit beta |
| 12 | 20 | 57 | -0.953 | | 
Residual = 0.609 |  | 
GcTGCGAAtACTGC | 
GaGTggGgGCC |  | MMP0137 MMP0161 MMP0242 MMP0308 MMP0595 MMP0641 MMP0705 MMP0884 MMP0945 MMP0947 MMP0950 MMP0970 MMP1004 MMP1005 MMP1105 MMP1122 MMP1124 MMP1307 MMP1515 MMP1614 | dys comB rpl7ae wbpI hisG lig trpF trpG sucC hsp60 hisS | putative deoxyhypusine synthase | 2-phosphosulfolactate phosphatase | hypothetical protein | SirA family protein | 50S ribosomal protein L7Ae | UDP-N-acetylglucosamine 2-epimerase | glyceraldehyde-3-phosphate ferredoxin oxidoreductase | ATP phosphoribosyltransferase | DNA ligase I, ATP-dependent Dnl1 | N-(5'-phosphoribosyl)anthranilate isomerase | anthranilate synthase component II | succinate-CoA ligase (ADP-forming), beta chain | translation-associated GTPase | thiamine-monophosphate kinase | methyltransferase related protein | chaperonin GroEL | histidyl-tRNA synthetase |
| 13 | 18 | 58 | -0.372 | | 
Residual = 0.562 |  | 
CCTGTtGCCg | 
gCcTTCCacCG |  | MMP0073 MMP0094 MMP0135 MMP0136 MMP0143 MMP0150 MMP0572 MMP0698 MMP0881 MMP0955 MMP1101 MMP1198 MMP1254 MMP1370 MMP1410 MMP1421 MMP1424 MMP1473 | argG thrC leuD slyD sucD purM aEF-1_alpha rpl24p rpl15p | argininosuccinate synthase | THUMP domain protein | threonine synthase | 3-isopropylmalate dehydratase, small subunit | hypothetical protein | peptidylprolyl isomerase, FKBP-type | succinyl-CoA synthetase subunit alpha | acetylornithine aminotransferase | nitrate/sulfonate/bicarbonate ABC transporter ATPase | phosphoribosylaminoimidazole synthetase | elongation factor 1-alpha | 50S ribosomal protein L24P | 50S ribosomal protein L15P | oligosaccharyl transferase, STT3 subunit |
| 14 | 33 | 58 | -0.373 | | 
Residual = 0.767 |  | 
ngtaAAATttatAAAAaTgt | 
AcnGCAGGTG |  | MMP0028 MMP0037 MMP0112 MMP0113 MMP0185 MMP0187 MMP0188 MMP0189 MMP0266 MMP0267 MMP0279 MMP0301 MMP0425 MMP0426 MMP0466 MMP0467 MMP0471 MMP0488 MMP0619 MMP0643 MMP0655 MMP0688 MMP0776 MMP0837 MMP0890 MMP0957 MMP1026 MMP1125 MMP1146 MMP1215 MMP1577 MMP1624 MMP1656 | mtaP thiC mptG hypA dsbD argS purF hat ehbK | cobyrinic acid a,c-diamide synthase | metal dependent phosphohydrolase | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase 2 | hypothetical protein | 5'-methylthioadenosine phosphorylase | thiamine biosynthesis protein ThiC | diphthamide biosynthesis protein | MarC family integral membrane protein | beta-ribofuranosylaminobenzene 5'-phosphate synthase family | hydrogenase nickel insertion protein HypA | nitroreductase family protein | low molecular weight phosphotyrosine protein phosphatase | thiamineS protein | O-phosphoseryl-tRNA synthetase | ribonuclease H | superfamily II helicase | arginyl-tRNA synthetase | amidophosphoribosyltransferase | cobyric acid synthase | histone acetyltransferase, ELP3 family | polyferredoxin | glutamine amidotransferase subunit PdxT |
| 15 | 22 | 58 | -2.161 | | 
Residual = 0.624 |  | 
gGGGGA | 
tATTTtaAtTTTaAaTTTAtg |  | MMP0181 MMP0191 MMP0283 MMP0285 MMP0286 MMP0294 MMP0295 MMP0533 MMP0534 MMP0535 MMP0709 MMP0710 MMP0733 MMP0792 MMP0813 MMP0863 MMP0963 MMP1165 MMP1173 MMP1174 MMP1293 MMP1486 | ndk thrB transporting | hypothetical protein | nucleoside-diphosphate kinase | TrkA-N domain protein | Pyrrolo-quinoline quinone | homoserine kinase | MscS mechanosensitive ion channel | ATPase, P-type (transporting), HAD superfamily, subfamily IC | putative membrane pump | membrane protein | CBS domain-containing protein | MIP family channel protein | heavy metal translocating P-type ATPase | zinc/iron permease | peroxiredoxin | glycosyl transferase, group 1 |
| 16 | 23 | 57 | -1.971 | | 
Residual = 0.907 |  | 
AatatTAcTTtcTaAAAATtT | 
GAAAAGgaGGg |  | MMP0201 MMP0307 MMP0347 MMP0365 MMP0379 MMP0381 MMP0399 MMP0406 MMP0412 MMP0558 MMP0672 MMP0698 MMP0929 MMP1032 MMP1078 MMP1279 MMP1306 MMP1391 MMP1518 MMP1532 MMP1536 MMP1544 MMP1554 | moeA htpX rpa asd pgk rpl4lp | molybdenum cofactor biosynthesis protein | hypothetical protein | 3-isopropylmalate dehydratase, small subunit | heat shock protein HtpX | putative TIM-barrel protein | MiaB-like tRNA modifying protein | binding-protein dependent transport system inner membrane protein | methyl-accepting chemotaxis sensory transducer | replication factor A | camphor resistance CrcB protein | aspartate-semialdehyde dehydrogenase | sulfate/molybdate ABC-transporter homolog, ATPase subunit | phosphoglycerate kinase | 50S ribosomal protein L4P |
| 17 | 25 | 55 | -0.449 | | 
Residual = 0.579 |  | 
TtTTAAAaTatAt | 
CgTgTAcAAATcCcG |  | MMP0044 MMP0045 MMP0146 MMP0167 MMP0179 MMP0264 MMP0571 MMP0583 MMP0620 MMP0661 MMP0732 MMP0882 MMP0942 MMP0943 MMP0969 MMP1013 MMP1104 MMP1183 MMP1272 MMP1312 MMP1314 MMP1431 MMP1509 MMP1510 MMP1592 | idsA purL MscMJ moaA atwA xseA purM taqD carB pyrI vorB 2pgk gatA trpS | beta-lactamase domain protein | bifunctional short chain isoprenyl diphosphate synthase | hypothetical protein | ABC transporter ATP-binding protein | phosphoribosylformylglycinamidine synthase | MscS mechanosensitive ion channel | molybdenum cofactor biosynthesis protein A | branched chain amino acid ABC transporter | methyl coenzyme M reductase, component A2 | putative ATP binding related protein | exodeoxyribonuclease VII large subunit | AIR synthase related protein domain protein | glycerol-3-phosphate cytidyltransferase | carbamoyl-phosphate synthase large chain | aspartate carbamoyltransferase regulatory subunit | iron ABC transporter ATPase subunit | 2-ketoisovalerate ferredoxin reductase | phosphoesterase domain-containing protein | 2-phosphoglycerate kinase | aspartyl/glutamyl-tRNA amidotransferase subunit A | tryptophanyl-tRNA synthetase |
| 18 | 30 | 57 | 2.005 | | 
Residual = 1.000 |  | 
TgTGgtnGtGTcCcgAtGCCtAg | 
GGGTTCgAATCCCgcCGGGTCCgC |  | MMP0019 MMP0159 MMP0182 MMP0236 MMP0245 MMP0389 MMP0434 MMP0452 MMP0468 MMP0476 MMP0477 MMP0483 MMP0503 MMP0574 MMP0746 MMP0763 MMP0782 MMP0786 MMP1576 Mma-sR06 RNA_11 RNA_19 RNA_37 RNA_38 RNA_4 RNA_40 RNA_42 RNA_44 RNA_48 RNA_50 | rpl39e pfdB tRNA-Glu1 tRNA-Met1 rrnD5S rrnA23S tRNA-Ala2 rrnB23S rrnC23S rrnC16S rnnC5S tRNA-SeC1 | hypothetical protein | 50S ribosomal protein L39e | prefoldin, beta subunit | ferredoxin | tRNA-Glu | tRNA-Met | 5S ribosomal RNA | 23S ribosomal RNA | tRNA-Ala | 16S ribosomal RNA | tRNA-Sec |
| 19 | 22 | 58 | -0.082 | | 
Residual = 0.602 |  | 
CCAtgTTT | 
cTgGCCTC |  | MMP0080 MMP0093 MMP0106 MMP0160 MMP0250 MMP0251 MMP0252 MMP0260 MMP0442 MMP0450 MMP0738 MMP0878 MMP0989 MMP1101 MMP1115 MMP1148 MMP1253 MMP1434 MMP1441 MMP1535 MMP1581 MMP1584 | ftsA-2 psmA rpl1P top6B Sm protein nusG mobB | glutamate synthase; large subunit; subunit 1 | 50S ribosomal protein L21e | hypothetical protein | coenzyme F390 synthetase | putative RNA-associated protein | proteasome subunit alpha | 50S ribosomal protein L1P | ferredoxin | elongation factor Tu domain-containing protein | ribonuclease P-related protein | DNA topoisomerase VI subunit B | acetylornithine aminotransferase | transketolase, N terminal half | small nuclear ribonucleoprotein (Sm protein) | transcription antitermination protein NusG | molybdopterin-guanine dinucleotide biosynthesis protein | putative DNA helicase | spermidine synthase |
| 20 | 17 | 57 | -1.362 | | 
Residual = 0.567 |  | 
gATtAtTtTGGTGA | 
GCACCTCC |  | MMP0063 MMP0078 MMP0094 MMP0410 MMP0697 MMP0878 MMP0937 MMP1207 MMP1217 MMP1319 MMP1324 MMP1391 MMP1399 MMP1425 MMP1426 MMP1705 MMP1707 | argB prsA leuS cofE rps13p rpl13p asd dcd aIF2_alpha | acetylglutamate kinase | hypothetical protein | THUMP domain protein | ribose-phosphate pyrophosphokinase | leucyl-tRNA synthetase | ribonuclease P-related protein | F420-0--gamma-glutamyl ligase | 30S ribosomal protein S6e | 30S ribosomal protein S13P | 50S ribosomal protein L13P | aspartate-semialdehyde dehydrogenase | aspartate/glutamate/uridylate kinase | tRNA 2'-O-methylase | bifunctional dCTP deaminase/dUTP diphosphatase | creatininase | translation initiation factor IF-2 subunit alpha |
| 21 | 25 | 58 | -0.783 | | 
Residual = 0.747 |  | 
TgtgCGAAAAaAaaATanAt | 
GCCgaATGg |  | MMP0074 MMP0208 MMP0249 MMP0281 MMP0346 MMP0358 MMP0522 MMP0524 MMP0525 MMP0769 MMP0873 MMP0974 MMP0976 MMP1037 MMP1136 MMP1139 MMP1143 MMP1175 MMP1191 MMP1372 MMP1476 MMP1529 MMP1538 MMP1639 MMP1650 | rpl37ae thiE mch manB | hypothetical protein | 50S ribosomal protein L37Ae | ATPase | 2-hydroxyglutaryl-CoA dehydratase subunit D-like protein | TPR repeat-containing protein | rubrerythrin | thiamine-phosphate pyrophosphorylase | N(5),N(10)-methenyltetrahydromethanopterin cyclohydrolase | phosphomannomutase | methyltransferase type 11 | transporter component | phosphomethylpyrimidine kinase | NifC-like ABC-type porter |
| 22 | 29 | 59 | 0.057 | | 
Residual = 0.853 |  | 
ttatTaaatnTAATTTTtAA | 
TCCcCCC |  | MMP0027 MMP0046 MMP0141 MMP0184 MMP0214 MMP0384 MMP0444 MMP0628 MMP0630 MMP0885 MMP0901 MMP0968 MMP0992 MMP0993 MMP1134 MMP1141 MMP1235 MMP1237 MMP1241 MMP1400 MMP1401 MMP1402 MMP1428 MMP1464 MMP1482 MMP1569 Mma-sR01 Mma-sR03 Mma-sR07 | feoB hisD moaE ef1B ehaQ | TrkA-N domain protein | hypothetical protein | non-canonical purine NTP pyrophosphatase, rdgB/HAM1 family | 30S ribosomal protein S27ae | TOBE domain protein | ferrous iron transporter (GTP-binding) | ATP/GTP-binding motif-containing protein | histidinol dehydrogenase | XRE family transcriptional regulator | type A flavoprotein | ATP-dependent helicase | molybdopterin biosynthesis MoaE | elongation factor 1-beta | cobalt transport protein CbiN |
| 23 | 27 | 56 | -0.442 | | 
Residual = 0.777 |  | 
cATtTGGgGGA | 
gGCtcGGGcAg |  | MMP0003 MMP0118 MMP0119 MMP0198 MMP0297 MMP0305 MMP0327 MMP0329 MMP0330 MMP0604 MMP0607 MMP0729 MMP0973 MMP0987 MMP1002 MMP1007 MMP1008 MMP1127 MMP1204 MMP1234 MMP1240 MMP1282 MMP1461 MMP1484 MMP1607 MMP1632 MMP1696 | korA birA III aIF-2_beta deoA cbiC nrpR uvrA ksgA trpA trpD trpC ehaN cbiO yqiX vhuD | 2-oxoglutarate ferredoxin oxidoreductase subunit alpha | beta-lactamase domain protein | biotin--acetyl-CoA-carboxylase ligase | ABC-type iron(III) transport system, ATP binding protein | translation initiation factor IF-2 subunit beta | 2-oxoacid ferredoxin oxidoreductase subunit beta | thymidine phosphorylase | hypothetical protein | precorrin-8X methylmutase | excinuclease ABC subunit A | dimethyladenosine transferase | tryptophan synthase subunit alpha | anthranilate phosphoribosyltransferase | indole-3-glycerol-phosphate synthase | RNA binding S1 domain protein | M24 family metallopeptidase | UBA/THIF-type NAD/FAD binding protein | Sep-tRNA:Cys-tRNA synthetase | energy conserving hydrogenase A small subunit | cobalt transporter ATP-binding subunit | glutamate-binding protein | F420-non-reducing hydrogenase subunit delta |
| 24 | 25 | 57 | 0.448 | | 
Residual = 0.743 |  | 
CGCCCc | 
CCcCCTC |  | MMP0140 MMP0271 MMP0451 MMP0501 MMP0565 MMP0568 MMP0681 MMP0721 MMP0722 MMP0723 MMP0750 MMP0759 MMP0767 MMP0780 MMP0794 MMP0853 MMP1185 MMP1193 MMP1194 MMP1276 MMP1379 MMP1436 MMP1463 RNA_13 RNA_30 | NiFe nifH thyA ftsZ1 ehaP tRNA-Ser1 tRNA-Gly2 | (NiFe) hydrogenase maturation protein HypF | ATP binding putative nickel incorporation protein | hypothetical protein | transcriptional regulator related protein | xanthine/uracil permease family protein | ferredoxin | nitrogenase reductase | hydrogen uptake protein:hydrogenase maturation protease HycI | triple helix repeat-containing collagen | thymidylate synthase | cell division protein FtsZ | polyferredoxin | tRNA-Ser | tRNA-Gly |
| 25 | 11 | 57 | -3.484 | | 
Residual = 0.439 |  | 
TatTTGtAtaAATAAaTgtA | 
CGAAgACaGCG |  | MMP0024 MMP0083 MMP0697 MMP0947 MMP1021 MMP1106 MMP1207 MMP1255 MMP1445 MMP1592 MMP1705 | leuS hisG pheT guaA trpS | ATPase | coenzyme F420 hydrogenase/dehydrogenase beta subunit domain protein | leucyl-tRNA synthetase | ATP phosphoribosyltransferase | hypothetical protein | 30S ribosomal protein S6e | phenylalanyl-tRNA synthetase subunit beta | GMP synthase subunit A | tryptophanyl-tRNA synthetase | creatininase |
| 26 | 15 | 58 | -2.347 | | 
Residual = 0.326 |  | 
tGGAGG | 
GcCGaG |  | MMP0107 MMP0584 MMP0946 MMP1255 MMP1364 MMP1366 MMP1409 MMP1411 MMP1412 MMP1415 MMP1418 MMP1420 MMP1545 MMP1546 MMP1547 | valS gatB pheT rpoA2 nusA rpl14p rpl5p rpl6p rpl18p rpl30p rplW rpl2p rps19p | hypothetical protein | valyl-tRNA synthetase | aspartyl/glutamyl-tRNA amidotransferase subunit B | phenylalanyl-tRNA synthetase subunit beta | DNA-directed RNA polymerase subunit A'' | transcription elongation factor NusA | 50S ribosomal protein L14P | 30S ribosomal protein S4e | 50S ribosomal protein L5P | 50S ribosomal protein L6P | 50S ribosomal protein L18P | 50S ribosomal protein L30P | 50S ribosomal protein L23 | 50S ribosomal protein L2P | 30S ribosomal protein S19P |
| 27 | 24 | 57 | -0.624 | | 
Residual = 0.627 |  | 
AtAtatnaAAAAtaA | 
cGCACGG |  | MMP0013 MMP0014 MMP0024 MMP0146 MMP0175 MMP0176 MMP0421 MMP0422 MMP0429 MMP0443 MMP0651 MMP0859 MMP0868 MMP0902 MMP0955 MMP1090 MMP1105 MMP1230 MMP1345 MMP1425 MMP1489 MMP1517 MMP1527 MMP1611 | argH truD rps24e ilvH nifN proV sucD sucC di-trans-poly-cis-decaprenylcistransferase pnk | argininosuccinate lyase | tRNA pseudouridine synthase D | ATPase | hypothetical protein | cell division protein CDC48 | 30S ribosomal protein S24e | acetolactate synthase 3 regulatory subunit | nitrogenase | ABC transporter ATPase | succinyl-CoA synthetase subunit alpha | NAD-dependent epimerase/dehydratase | succinate-CoA ligase (ADP-forming), beta chain | DNA polymerase, beta-like region | undecaprenyl pyrophospahte synthetase related protein (di-trans-poly-cis-decaprenylcistransferase) | tRNA 2'-O-methylase | inorganic polyphosphate/ATP-NAD kinase | peptidase M50 | aspartate aminotransferase |
| 28 | 31 | 59 | 0.251 | | 
Residual = 0.869 |  | 
tcCTCCCCCtGAT | 
CGGAGG |  | MMP0037 MMP0095 MMP0105 MMP0110 MMP0162 MMP0216 MMP0276 MMP0319 MMP0320 MMP0328 MMP0345 MMP0346 MMP0353 MMP0372 MMP0392 MMP0405 MMP0521 MMP0564 MMP0685 MMP0770 MMP0774 MMP0779 MMP0829 MMP0858 MMP0931 MMP1138 MMP1233 MMP1267 MMP1386 MMP1582 MMP1642 | cbiL mtd purD gch3 nifE thiM pdaD | metal dependent phosphohydrolase | hypothetical protein | ABC transporter:AAA ATPase | cation transport ATPase | precorrin-2 C-20 methyltransferase | shikimate kinase | 2-hydroxyglutaryl-CoA dehydratase subunit D-like protein | UDP-glucose/GDP-mannose dehydrogenase related protein | F420-dependent methylenetetrahydromethanopterin dehydrogenase | phosphoribosylamine--glycine ligase | GTP cyclohydrolase III | N-6 adenine-specific DNA methylase | ABC transporter | coenzyme B12-binding:cobalamin-dependent methionine synthase, B12-binding | nitrogenase MoFe cofactor biosynthesis protein NifE | CheC, inhibitor of MCP methylation | hydroxyethylthiazole kinase | formate dehydrogenase family accessory protein FdhD | pyruvoyl-dependent arginine decarboxylase | ATP/GTP-binding motif-containing protein |
| 29 | 32 | 58 | -0.537 | | 
Residual = 0.731 |  | 
TtTAAAtcGAtTTTT | 
TtcCCCC |  | MMP0101 MMP0170 MMP0206 MMP0213 MMP0255 MMP0275 MMP0331 MMP0369 MMP0437 MMP0571 MMP0586 MMP0644 MMP0645 MMP0834 MMP1057 MMP1068 MMP1074 MMP1127 MMP1178 MMP1192 MMP1297 MMP1298 MMP1317 MMP1336 MMP1507 MMP1531 MMP1621 MMP1622 MMP1623 MMP1625 MMP1626 MMP1629 | cofF modB HIT moaA mdh mtbA ehbD fdhB fdhA selB porC ehbO ehbM ehbL ehbJ ehbE | hypothetical protein | alpha-L-glutamate ligase, RimK family | molybdenum ABC transporter, permease protein | triphosphoribosyl-dephospho-CoA protein | isoleucyl-tRNA synthetase related | periplasmic copper-binding | histidine triad (HIT) protein | molybdenum cofactor biosynthesis protein A | uncharacterized endonuclease III related protein | cation diffusion facilitator family transporter | malate dehydrogenase | uroporphyrinogen decarboxylase | K+-dependent Na+/Ca+ exchanger related-protein:Sodium/calcium exchanger membrane region | RNA binding S1 domain protein | periplasmic binding protein | radical SAM domain protein | formate dehydrogenase beta subunit | formate dehydrogenase alpha subunit | translation factor specialized for selenocysteine insertion | pyruvate ferredoxin oxidoreductase subunit gamma | energy conserving hydrogenase B integral membrane subunit | energy conserving hydrogenase B small subunit | ferredoxin | putative monovalent cation/H+ antiporter subunit B | putative monovalent cation/H+ antiporter subunit C |
| 30 | 26 | 57 | -0.539 | | 
Residual = 0.804 |  | 
tTtAAAtTtcCannA | 
CCcCCcC |  | MMP0008 MMP0140 MMP0222 MMP0302 MMP0303 MMP0315 MMP0539 MMP0612 MMP0628 MMP0639 MMP0646 MMP0826 MMP0903 MMP0904 MMP0952 MMP0965 MMP0978 MMP0979 MMP1068 MMP1099 MMP1228 MMP1615 MMP1619 MMP1620 Mma-sR08 RNA_14 | DP1 NiFe Cys iorB1 leuB LigT selD aIF-5A tRNA-Arg2 | DNA polymerase II small subunit | (NiFe) hydrogenase maturation protein HypF | hypothetical protein | rubredoxin-type Fe(Cys)4 protein | indolepyruvate oxidoreductase subunit B | multifunctional 3-isopropylmalate dehydrogenase/D-malate dehydrogenase | 2'-5' RNA ligase | TOBE domain protein | 50S ribosomal protein L23E | selenophosphate synthetase | translation initiation factor IF-5A | formylmethanofuran dehydrogenase subunit E related protein | K+-dependent Na+/Ca+ exchanger related-protein:Sodium/calcium exchanger membrane region | phosphate transporter PhoU | molybdenum cofactor biosynthesis protein MoeA | tRNA-Arg |
| 31 | 28 | 57 | -0.899 | | 
Residual = 0.924 |  | 
cTGgGcCGAT | 
AcACCATATtT |  | MMP0060 MMP0071 MMP0112 MMP0128 MMP0243 MMP0258 MMP0331 MMP0360 MMP0369 MMP0509 MMP0655 MMP0677 MMP0696 MMP0800 MMP0847 MMP0848 MMP0849 MMP0921 MMP0977 MMP0978 MMP1049 MMP1119 MMP1180 MMP1186 MMP1395 MMP1455 MMP1635 RNA_17 | rpl12p HIT fmdA proS CooC yjlA lon ehaH tRNA-Pro2 | ribosomal LX protein | DNA primase, small subunit | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase 2 | cyclase family protein | hypothetical protein | 50S ribosomal protein L12P | histidine triad (HIT) protein | formylmethanofuran dehydrogenase, subunit A | thiamineS protein | prolyl-tRNA synthetase | peptide methionine sulfoxide reductase | L-lysine/ homoserine-homoserine lactone exporter family protein | RNAse P, Rpr2/Rpp21 subunit | CO dehydrogenase maturation factor | multiple resistance and pH regulation protein F | thiol (cysteine) protease | Hef nuclease | putative transmembrane subunit of a hydrogenase | redox-active disulfide protein 1 | tRNA-Pro |
| 32 | 20 | 58 | -1.427 | | 
Residual = 0.664 |  | 
CGGaGGGG | 
TAcattTAnacAtATCtGGG |  | MMP0018 MMP0451 MMP0453 MMP0455 MMP0462 MMP0464 MMP0486 MMP0495 MMP0502 MMP0511 MMP0691 MMP0743 MMP0744 MMP0748 MMP0749 MMP0750 MMP0773 MMP0776 MMP0781 MMP1086 | fmdB | LysR family transcriptional regulator | hypothetical protein | neutral zinc metallopeptidase | amino-acid ABC transporter | molybdenum containing formylmethanofuran dehydrogenase, subunit B | integrase/recombinase | MCE family-like protein |
| 33 | 28 | 58 | -2.488 | | 
Residual = 0.891 |  | 
TATAaTATtTTATAgTTATCgGT | 
cCTnTTaTATttAAgTncATaTAT |  | MMP0275 MMP0298 MMP0349 MMP0403 MMP0406 MMP0408 MMP0410 MMP0498 MMP0645 MMP0657 MMP0687 MMP0799 MMP0929 MMP0982 MMP1022 MMP1274 MMP1299 MMP1301 MMP1317 MMP1335 MMP1336 MMP1337 MMP1339 MMP1353 MMP1354 MMP1355 MMP1483 MMP1534 | rpl15 prsA mdh tpiA fdhC selB cbiQ | periplasmic copper-binding | 50S ribosomal protein L15e | 2-hydroxyglutaryl-CoA dehydratase subunit A-like protein | hypothetical protein | putative TIM-barrel protein | H+-transporting two-sector ATPase, A subunit | ribose-phosphate pyrophosphokinase | malate dehydrogenase | triosephosphate isomerase | TetR family transcriptional regulator Member | methyl-accepting chemotaxis sensory transducer | AMP-dependent synthetase and ligase | carbonic anhydrase | formate/nitrite transporter | mevalonate kinase | translation factor specialized for selenocysteine insertion | hydrogenase maturation protease, related | SAM-binding motif-containing protein | thiamine biosynthesis protein | hexapeptide repeat-containing transferase | cobalt ABC transporter inner membrane protein |
| 34 | 31 | 58 | -1.519 | | 
Residual = 0.936 |  | 
CCAcAaggTCcGcaGcCctc | 
CCcCCCAG |  | MMP0143 MMP0173 MMP0206 MMP0234 MMP0242 MMP0300 MMP0304 MMP0313 MMP0321 MMP0337 MMP0526 MMP0560 MMP0591 MMP0601 MMP0700 MMP0949 MMP0950 MMP0959 MMP1055 MMP1060 MMP1111 MMP1144 MMP1227 MMP1277 MMP1376 MMP1453 MMP1458 MMP1490 MMP1540 MMP1548 MMP1614 | modB trxB cysS modA cbiE sdhA ehaF ehaK hisS | hypothetical protein | molybdenum ABC transporter, permease protein | N-glycosylase/DNA lyase | SAM-binding motif-containing protein | ParR family transcriptional regulator | tRNA CCA-pyrophosphorylase | FAD-dependent pyridine nucleotide-disulphide oxidoreductase | cysteinyl-tRNA synthetase | bacitracin resistance protein BacA | cobalt-precorrin-6Y C(5)-methyltransferase | succinate dehydrogenase flavoprotein subunit | phage shock protein C, PspC | ATP/GTP-binding motif-containing protein | Fe-S type hydro-lyase tartrate/fumarate beta region | histidyl-tRNA synthetase |
| 35 | 18 | 57 | -3.809 | | 
Residual = 0.482 |  | 
tAAcCTACACAAAgA | 
gCgCCC |  | MMP0413 MMP0924 MMP0925 MMP1262 MMP1288 MMP1665 MMP1666 MMP1667 MMP1668 MMP1669 MMP1670 MMP1671 MMP1672 MMP1673 MMP1674 MMP1675 MMP1676 MMP1719 | cheW flaB1 flaB2 flaB3 flaC flaD flaE flaF flaG flaH flaI flaJ | hypothetical protein | chemotaxis protein CheW | UbiD family decarboxylase | HEAT domain containing protein | flagellin | flagella accessory C family protein | flagella protein | flagellar protein F | flagellar protein G | flagellar accessory protein FlaH | type II secretion system protein E | flagellar assembly protein J |
| 36 | 9 | 58 | -4.332 | | 
Residual = 0.169 |  | 
GcGGAG | 
GcCaAAgATgCAaA |  | MMP1154 MMP1155 MMP1156 MMP1157 MMP1158 MMP1159 MMP1160 MMP1161 MMP1163 | hdrC1 hdrB1 rbo | heterosulfide reductase, subunit C1 | heterosulfide reductase, subunit B1 | carboxymuconolactone decarboxylase | desulfoferrodoxin, ferrous iron-binding site | hypothetical protein | Ferritin | CutA1 divalent ion tolerance protein |
| 37 | 26 | 57 | -1.131 | | 
Residual = 0.935 |  | 
AATttatTtAAAAAg | 
GGGcGGAT |  | MMP0257 MMP0290 MMP0340 MMP0487 MMP0489 MMP0551 MMP0733 MMP0818 MMP0898 MMP0916 MMP0986 MMP1057 MMP1062 MMP1064 MMP1092 MMP1169 MMP1190 MMP1196 MMP1226 MMP1232 MMP1292 MMP1454 MMP1456 MMP1542 MMP1578 MMP1601 | tbp nac pycB frcG thyA ehaG ehaI | transcription factor | nascent polypeptide-associated complex protein | pyruvate carboxylase subunit B | hypothetical protein | binding-protein dependent transport system inner membrane protein | putative membrane pump | coenzyme F420-reducing hydrogenase subunit gamma | cellulose-binding | PRC-barrel domain protein | thymidylate synthase | adenylate cyclase | auxin efflux carrier | SufBD protein | peptidylprolyl isomerase, FKBP-type | geranylgeranyl reductase | PP-loop domain protein | glycoside hydrolase 15-related | translin family protein | nicotinamide-nucleotide adenylyltransferase | putative RNA methylase |
| 38 | 27 | 57 | -0.938 | | 
Residual = 0.726 |  | 
CGGTgTcgagcCgtaCcCgTTCCC | 
TTTGCCTCccGG |  | MMP0034 MMP0315 MMP0398 MMP0428 MMP0457 MMP0524 MMP0529 MMP0588 MMP0606 MMP0658 MMP0839 MMP0890 MMP0892 MMP0905 MMP0907 MMP0954 MMP1019 MMP1169 MMP1320 MMP1432 MMP1514 MMP1553 MMP1581 MMP1589 MMP1634 MMP1689 MMP1700 | iorB1 dph5 rps4p purA tyrA rdxA carA comE | GTP cyclohydrolase | indolepyruvate oxidoreductase subunit B | hypothetical protein | vanadium nitrogenase-associated related protein N | DEAD/DEAH box helicase domain protein | sulfate transporter family protein | diphthine synthase | ribosomal RNA methyltransferase RrmJ/FtsJ | MoaA/nifB/pqqE family protein | superfamily II helicase | GCN5-related N-acetyltransferase | transcriptional regulator TrmB | PEGA domain protein | SufBD protein | 30S ribosomal protein S4 | adenylosuccinate synthetase | prephenate dehydrogenase | nitroreductase family protein | putative DNA helicase | carbamoyl phosphate synthase small subunit | DsrE family protein | sulfopyruvate decarboxylase subunit beta | SSS sodium solute transporter superfamily |
| 39 | 27 | 58 | -1.204 | | 
Residual = 0.812 |  | 
GGGgGA | 
AnATATaTAAAnaTGTCATTAgAA |  | MMP0040 MMP0111 MMP0115 MMP0130 MMP0183 MMP0241 MMP0546 MMP0559 MMP0693 MMP0872 MMP0889 MMP0913 MMP0915 MMP0923 MMP0924 MMP0984 MMP1100 MMP1245 MMP1285 MMP1288 MMP1372 MMP1394 MMP1422 MMP1552 MMP1636 MMP1637 MMP1648 | fumA ribB hemC cobY/cofC dapB cdh fwdF manB aroD secY | type II secretion system protein E | hypothetical protein | nitroreductase | fumarate hydratase | 3,4-dihydroxy-2-butanone 4-phosphate synthase | AMMECR1 domain protein | aminoacyl-tRNA synthetase, class II | porphobilinogen deaminase | cobalt transport protein CbiM | nucleoside triphosphate: 5'-deoxyadenosylcobinamide phosphate nucleotidyltransferase | dihydrodipicolinate reductase | acetyl-CoA decarbonylase/synthase complex subunit epsilon | putative transcriptional regulator | tungsten containing formylmethanofuran dehydrogenase, subunit F | UbiD family decarboxylase | phosphomannomutase | 3-dehydroquinate dehydratase (Type I DHQase) | preprotein translocase subunit SecY | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase | major facilitator transporter |
| 40 | 13 | 56 | -1.627 | | 
Residual = 0.531 |  | 
GTGgAaGcCCTcAAAggcC | 
CTACGCG |  | MMP0015 MMP0212 MMP0573 MMP0587 MMP0661 MMP0670 MMP0868 MMP0901 MMP0954 MMP0969 MMP1183 MMP1437 MMP1543 | mobA napA proV top6A rpl3p | hypothetical protein | glycyl-tRNA synthetase | putative molybdopterin-guanine dinucleotide biosynthesis protein A | sodium/hydrogen exchanger | putative ATP binding related protein | ABC transporter ATPase | ATP/GTP-binding motif-containing protein | iron ABC transporter ATPase subunit | DNA topoisomerase VI subunit A | 50S ribosomal protein L3P |
| 41 | 33 | 56 | 0.655 | | 
Residual = 0.728 |  | 
TtaatacTgnTTTtTtaaAAttat | 
gAGgGGG |  | MMP0141 MMP0179 MMP0323 MMP0482 MMP0499 MMP0508 MMP0605 MMP0620 MMP0642 MMP0684 MMP0726 MMP0730 MMP0734 MMP0774 MMP0798 MMP0836 MMP0928 MMP0942 MMP0989 MMP1016 MMP1125 MMP1229 MMP1271 MMP1313 MMP1327 MMP1359 MMP1375 MMP1480 MMP1640 MMP1651 MMP1678 RNA_21 RNA_49 | purL fmdE atwA hsp20 cheD top6B vorA fen-1 rpoK modA nfo tRNA-Asn1 | hypothetical protein | phosphoribosylformylglycinamidine synthase | molybdenum containing formylmethanofuran dehydrogenase, subunit E | putative RNA-processing protein | methyl coenzyme M reductase, component A2 | heat shock protein Hsp20 | 2-hydroxyglutaryl-CoA dehydratase subunit D-like protein | chemoreceptor glutamine deamidase CheD | DNA topoisomerase VI subunit B | putative signal transduction protein with CBS domains | FUN14 family protein | 2-oxoisovalerate oxidoreductase subunit alpha | flap endonuclease-1 | RNA polymerase Rpb6 | SAM-binding motif-containing protein | aconitase family | S-adenosylmethionine synthetase | molybdenum ABC transporter periplasmic molybdate-binding protein | endonuclease IV | tRNA-Asn |
| 42 | 20 | 59 | -1.204 | | 
Residual = 0.592 |  | 
AGAAATCcgGG | 
GCAgGGcGG |  | MMP0046 MMP0210 MMP0371 MMP0417 MMP0418 MMP0419 MMP0420 MMP0421 MMP0422 MMP0423 MMP0425 MMP0426 MMP0598 MMP1090 MMP1112 MMP1270 MMP1308 MMP1349 MMP1351 MMP1352 | hisA tal | hypothetical protein | 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)me thylideneamino)imidazole-4-carboxamide isomerase | carbohydrate kinase, PfkB | sodium:neurotransmitter symporter | CBS domain-containing protein | nitroreductase family protein | phosphoglycerate mutase-related | NAD-dependent epimerase/dehydratase | bifunctional hexulose-6-phosphate synthase/ribonuclease regulator | putative translaldolase | NAD+ synthase related protein | ribulose-1,5-biphosphate synthetase |
| 43 | 30 | 56 | 0.368 | | 
Residual = 0.798 |  | 
CGgGGcG | 
GGGTGG |  | MMP0070 MMP0081 MMP0325 MMP0354 MMP0432 MMP0512 MMP0515 MMP0540 MMP0576 MMP0694 MMP0703 MMP0737 MMP0740 MMP0768 MMP0811 MMP0812 MMP0814 MMP0821 MMP0841 MMP0856 MMP0864 MMP0870 MMP0911 MMP1058 MMP1110 MMP1231 MMP1260 MMP1268 MMP1603 Mma-sR04 | gltB fmdB modB purC dapA vhcD nifD napA-2 | tungsten containing formylmethanofruran dehydrogenase subunit C-related protein | glutamate synthase; large subunit; subunit 2 | glyceraldehyde-3-phosphate dehydrogenase | putative oligosaccharide transporter | TatD-related deoxyribonuclease | molybdenum containing formylmethanofuran dehydrogenase, subunit B | molybdenum ABC transporter permease | phosphoribosylaminoimidazole-succinocarboxamide synthase | dihydrodipicolinate synthase | beta-lactamase-like protein | hypothetical protein | L-aspartate dehydrogenase | purine NTPase | coenzyme F420-non-reducing hydrogenase subunit delta | nitrogenase alpha chain | Na+/H+ exchanger | glycerate dehydrogenase | iron-sulfur flavoprotein | HAD family hydrolase fragment | ferredoxin |
| 44 | 24 | 56 | -1.597 | | 
Residual = 0.827 |  | 
TTAATtagTCAGG | 
CCCgnAGGGg |  | MMP0069 MMP0082 MMP0144 MMP0154 MMP0178 MMP0187 MMP0225 MMP0298 MMP0316 MMP0430 MMP0492 MMP0587 MMP0658 MMP0699 MMP0799 MMP0849 MMP0943 MMP0960 MMP0994 MMP0995 MMP1208 MMP1397 MMP1508 MMP1589 | hpcE purQ thiC gldA rpl15 iorA1 napA taqD aIF2_gamma smc1 carA | methylated-DNA--protein-cysteine methyltransferase | glutamate synthase; large subunit; subunit 3 | 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase. | hypothetical protein | phosphoribosylformylglycinamidine synthase I | thiamine biosynthesis protein ThiC | glycerol dehydrogenase | 50S ribosomal protein L15e | indolepyruvate oxidoreductase subunit alpha 1 | ribonuclease P | sodium/hydrogen exchanger | MoaA/nifB/pqqE family protein | MATE efflux family protein | TetR family transcriptional regulator Member | L-lysine/ homoserine-homoserine lactone exporter family protein | glycerol-3-phosphate cytidyltransferase | translation initiation factor IF-2 subunit gamma | structural maintenance of chromosome protein | carbamoyl phosphate synthase small subunit |
| 45 | 26 | 57 | -1.836 | | 
Residual = 0.581 |  | 
ACCtACATAAAaAa | 
ACAGAATtATgGtGG |  | MMP0276 MMP0343 MMP0364 MMP0370 MMP0372 MMP0373 MMP0376 MMP0377 MMP0395 MMP0413 MMP0926 MMP0931 MMP0933 MMP1252 MMP1665 MMP1666 MMP1667 MMP1668 MMP1669 MMP1670 MMP1671 MMP1672 MMP1673 MMP1675 MMP1676 MMP1719 | mtd cheB cheY flaB1 flaB2 flaB3 flaC flaD flaE flaF flaG flaI flaJ | hypothetical protein | F420-dependent methylenetetrahydromethanopterin dehydrogenase | ATP dependent DNA ligase | isoleucyl-tRNA synthetase related | response regulator receiver modulated CheB methylesterase | CheC, inhibitor of MCP methylation | response regulator receiver protein | CBS domain-containing protein | HEAT domain containing protein | flagellin | flagella accessory C family protein | flagella protein | flagellar protein F | flagellar protein G | type II secretion system protein E | flagellar assembly protein J |
| 46 | 16 | 57 | -1.769 | | 
Residual = 0.482 |  | 
GATGTGTGCTCCGAG | 
GCAAGTGGcGC |  | MMP0039 MMP0218 MMP0226 MMP0227 MMP0230 MMP0239 MMP0756 MMP0888 MMP0889 MMP0918 MMP1042 MMP1046 MMP1096 MMP1304 MMP1305 MMP1467 | nrdD asnB atpC atpD ehaT | hypothetical protein | ExsB family transcriptional regulator | anaerobic ribonucleoside-triphosphate reductase | metal dependent phosphohydrolase | cobalt transport protein CbiN | cobalt transport protein CbiM | asparagine synthase (glutamine-hydrolyzing) | V-type ATP synthase subunit C | V-type ATP synthase subunit D | phosphate ABC transporter inner membrane protein | response regulator receiver protein |
| 47 | 24 | 55 | 0.340 | | 
Residual = 0.589 |  | 
CCgtGTTCGAttCacGccCTtGGC | 
CACCGc |  | MMP0165 MMP0166 MMP0199 MMP0272 MMP0273 MMP0631 MMP0666 MMP0674 MMP0793 MMP0801 MMP0826 MMP0843 MMP0983 MMP0990 MMP1063 MMP1283 MMP1469 MMP1500 MMP1656 MMP1657 MMP1679 MMP1721 RNA_33 RNA_8 | comA cdhB leuA ehbA ftsz2 tRNA-Met3 tRNA-Ala2 | ABC transporter | MATE family drug/sodium antiporter | hypothetical protein | ABC transporter ATPase | phosphosulfolactate synthase | putatuve iron dependent repressor | Na/Pi-cotransporter II-related protein | helix-turn-helix DNA binding protein | acetyl-CoA decarbonylase/synthase complex subunit beta | 2-isopropylmalate synthase | putative monovalent cation/H+ antiporter subunit E | cell division protein FtsZ | glutamine amidotransferase subunit PdxT | tRNA-Met | tRNA-Ala |
| 48 | 28 | 57 | -0.373 | | 
Residual = 0.644 |  | 
GGccTgCTcACCaTGtCG | 
cAAtaGTGTnccatgTATCAngG |  | MMP0049 MMP0067 MMP0202 MMP0204 MMP0256 MMP0257 MMP0312 MMP0446 MMP0489 MMP0500 MMP0543 MMP0569 MMP0737 MMP0761 MMP0840 MMP0853 MMP1087 MMP1093 MMP1095 MMP1097 MMP1152 MMP1199 MMP1257 MMP1278 MMP1280 MMP1286 MMP1332 MMP1438 | glnK2 hisH tbp nifH coaD | carbonic anhydrase | nitrogen regulatory protein P-II | permease | hypothetical protein | imidazole glycerol phosphate synthase subunit HisH | transcription factor | nitrogen fixation-related protein | Iron-sulfur flavoprotein-related | L-aspartate dehydrogenase | TetR family transcriptional regulator | nitrogenase reductase | phosphopantetheine adenylyltransferase | phosphate-binding protein | phosphate ABC transporter inner membrane protein | phosphate transporter PhoU | NERD domain protein | DNA primase | FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
| 49 | 28 | 56 | 0.218 | | 
Residual = 0.860 |  | 
GaGcGtGGCG | 
CCCgtCG |  | MMP0033 MMP0190 MMP0279 MMP0322 MMP0465 MMP0561 MMP0564 MMP0652 MMP0653 MMP0740 MMP0757 MMP0759 MMP0770 MMP0824 MMP0829 MMP0830 MMP0831 MMP0841 MMP0899 MMP1020 MMP1194 MMP1520 MMP1554 MMP1580 MMP1690 MMP1717 RNA_39 RNA_41 | mptG rfcB cmd vhcB mtaA mtbA rrnA16S rrnB16S | LysR family protein | hypothetical protein | beta-ribofuranosylaminobenzene 5'-phosphate synthase family | replication factor C large subunit | carboxymuconolactone decarboxylase | bile acid:sodium symporter | purine NTPase | ABC transporter | coenzyme F420-non-reducing hydrogenase subunit beta | coenzyme B12-binding:cobalamin-dependent methionine synthase, B12-binding | uroporphyrinogen decarboxylase | methylcobalamin:coenzyme M methyltransferase | ATP/GTP-binding motif-containing protein | triple helix repeat-containing collagen | hydrogenase accessory protein HypB | dihydropteroate synthase | hisA/hisF family protein | methyltransferase type 12 | 16S ribosomal RNA |
| 50 | 19 | 55 | -0.614 | | 
Residual = 0.621 |  | 
CTTtgGaGGgG | 
CCCCntTTTAA |  | MMP0064 MMP0131 MMP0138 MMP0190 MMP0192 MMP0293 MMP0440 MMP0567 MMP0702 MMP0718 MMP0857 MMP1089 MMP1246 MMP1302 MMP1380 MMP1383 MMP1385 MMP1694 RNA_32 | glnK1 fdhA nifK fwdG fruD fruB vhuA tRNA-Ser3 | nitrogen regulatory protein P-II | L-tyrosine decarboxylase | formate dehydrogenase alpha subunit | hypothetical protein | aldolase | DNA-directed RNA polymerase subunit E' | nitrogenase | polysaccharide biosynthesis protein | tungsten containing formylmethanofuran dehydrogenase, subunit G | chlorohydrolase | coenzyme F420-reducing hydrogenase delta subunit | coenzyme F420-reducing hydrogenase subunit beta | F420-non-reducing hydrogenase subunit alpha | tRNA-Ser |
| 51 | 27 | 58 | -0.220 | | 
Residual = 0.792 |  | 
gTTTTaaGGTt | 
GGCGtTGGaGg |  | MMP0368 MMP0390 MMP0415 MMP0636 MMP0861 MMP0862 MMP0897 MMP0910 MMP0917 MMP1029 MMP1030 MMP1031 MMP1085 MMP1111 MMP1142 MMP1171 MMP1263 MMP1318 MMP1328 MMP1335 MMP1342 MMP1346 MMP1348 MMP1357 MMP1392 MMP1444 MMP1531 | kamA yodP argJ dapF adkA modA pssA lysS | hypothetical protein | O-sialoglycoprotein endopeptidase/protein kinase | lysine 2,3-aminomutase | GCN5-related N-acetyltransferase | bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein | diaminopimelate epimerase | adenylate kinase | metallophosphoesterase | CDP-diacylglycerol--serine O-phosphatidyltransferase | lysyl-tRNA synthetase | enolase | mevalonate kinase | basic helix-loop-helix dimerization domain-containing protein | thiamineS protein | methionine aminopeptidase |
| 52 | 24 | 56 | -0.926 | | 
Residual = 0.694 |  | 
GAtGtACTtaCtTGGAAAGTctTA | 
GCGAGGTGCG |  | MMP0084 MMP0085 MMP0371 MMP0423 MMP0478 MMP0554 MMP0576 MMP0616 MMP0891 MMP0906 MMP0936 MMP0985 MMP0999 MMP1102 MMP1146 MMP1147 MMP1149 MMP1151 MMP1152 MMP1200 MMP1242 MMP1320 MMP1323 MMP1483 | dapA aroE cdhA purF rpl37e leuC mtbC lysA nadA rps4p cbiQ | hypothetical protein | SAM-binding motif-containing protein | dihydrodipicolinate synthase | OB-fold nucleic acid binding domain-containing protein | exonuclease | ribonuclease Z | shikimate 5-dehydrogenase | acetyl-CoA decarbonylase/synthase complex subunit alpha | phospholipase D/transphosphatidylase | amidophosphoribosyltransferase | 50S ribosomal protein L37e | 3-isopropylmalate dehydratase | coenzyme B12-binding:cobalamin-dependent methionine synthase, B12-binding | diaminopimelate decarboxylase | quinolinate synthetase | 30S ribosomal protein S4 | 50S ribosomal protein L18e | cobalt ABC transporter inner membrane protein |
| 53 | 22 | 57 | -1.397 | | 
Residual = 0.695 |  | 
CCGCng | 
gcgGGTAgCACC |  | MMP0012 MMP0104 MMP0120 MMP0204 MMP0218 MMP0256 MMP0376 MMP0539 MMP0613 MMP0637 MMP0687 MMP0888 MMP0953 MMP1162 MMP1191 MMP1234 MMP1261 MMP1512 MMP1513 MMP1645 MMP1677 MMP1711 | hisH leuB tpiA cbiH mch alr ald S pcnA | CoA-binding domain protein | polyferredoxin | hypothetical protein | imidazole glycerol phosphate synthase subunit HisH | ATP dependent DNA ligase | multifunctional 3-isopropylmalate dehydrogenase/D-malate dehydrogenase | acetolactate decarboxylase | ArsR family transcriptional regulator | triosephosphate isomerase | cobalt transport protein CbiN | precorrin-3B C17-methyltransferase | beta-lactamase domain protein | N(5),N(10)-methenyltetrahydromethanopterin cyclohydrolase | UBA/THIF-type NAD/FAD binding protein | alanine racemase | alanine dehydrogenase | aspartate/glutamate/uridylate kinase | (S)-2,3-di-O-geranylgeranylglyceryl phosphate synthase | proliferating cell nuclear antigen |
| 54 | 28 | 57 | -1.044 | | 
Residual = 0.568 |  | 
tGGTGaAA | 
CGGagGcGcTCGgG |  | MMP0090 MMP0099 MMP0124 MMP0282 MMP0342 MMP0345 MMP0349 MMP0355 MMP0383 MMP0392 MMP0394 MMP0408 MMP0409 MMP0858 MMP0897 MMP0918 MMP0922 MMP0925 MMP0926 MMP0927 MMP0932 MMP1023 MMP1077 MMP1139 MMP1144 MMP1307 MMP1616 MMP1701 | purE slp purD hemD nifE argJ asnB cheW cheB cheA thiE aspC | glycosyl transferase | major facilitator transporter | membrane-bound metal-dependent hydrolase | phosphoribosylaminoimidazole carboxylase, catalytic subunit | hypothetical protein | 2-hydroxyglutaryl-CoA dehydratase subunit A-like protein | S-layer protein | phosphoribosylamine--glycine ligase | uroporphyrinogen III synthase | H+-transporting two-sector ATPase, A subunit | glucose-methanol-choline oxidoreductase | nitrogenase MoFe cofactor biosynthesis protein NifE | bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein | asparagine synthase (glutamine-hydrolyzing) | putative phage infection protein | chemotaxis protein CheW | response regulator receiver modulated CheB methylesterase | CheA signal transduction histidine kinase | CheC, inhibitor of MCP methylation | TetR family transcriptional regulator | phosphoglucomutase/phosphomannomutase:calcium- bin ding EF-hand | thiamine-phosphate pyrophosphorylase | bacitracin resistance protein BacA | methyltransferase related protein | aspartyl-tRNA synthetase | amino acid-binding ACT domain protein |
| 55 | 26 | 59 | 0.494 | | 
Residual = 0.590 |  | 
CGAGgGG | 
CACCGG |  | MMP0173 MMP0475 MMP0556 MMP0563 MMP0772 MMP0784 MMP0790 MMP0792 MMP0793 MMP0795 MMP0796 MMP0797 MMP0800 MMP0805 MMP0808 MMP0819 MMP0822 MMP0823 MMP0895 MMP0896 MMP1179 MMP1181 MMP1526 MMP1529 MMP1649 MMP1650 | frcD vhcG vhcA rncS modC | hypothetical protein | TatD-related deoxyribonuclease | membrane protein | sugar efflux transporter | general substrate transporter | coenzyme F420-reducing hydrogenase subunit delta | coenzyme F420-non-reducing hydrogenase subunit gamma | coenzyme F420-non-reducing hydrogenase subunit alpha | TPR repeat-containing protein | polysaccharide biosynthesis protein | methyltransferase | iron transport system binding protein | ribonuclease III family protein | methyltransferase type 11 | ABC transporter ATPase | NifC-like ABC-type porter |
| 56 | 23 | 55 | -0.933 | | 
Residual = 0.675 |  | 
TTtTTcgGTaaTgT | 
GGAAAgGcCGgTGG |  | MMP0031 MMP0128 MMP0137 MMP0261 MMP0309 MMP0400 MMP0531 MMP0625 MMP0716 MMP0883 MMP0919 MMP1004 MMP1005 MMP1008 MMP1122 MMP1187 MMP1264 MMP1316 MMP1396 MMP1427 MMP1443 MMP1444 MMP1580 | dys ehbQ trpF trpG trpC fucA korB | hypothetical protein | cyclase family protein | putative deoxyhypusine synthase | DNA directed RNA polymerase; subunit L | DsrE family protein | amino acid-binding ACT domain protein | 50S ribosomal protein L14e | dihydroorotate dehydrogenase electron transfer subunit | N-(5'-phosphoribosyl)anthranilate isomerase | anthranilate synthase component II | indole-3-glycerol-phosphate synthase | translation-associated GTPase | class II aldolase/adducin family protein | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | aminotransferase | ATP/GTP-binding motif-containing protein | methionine aminopeptidase | dihydropteroate synthase |
| 57 | 21 | 57 | 0.760 | | 
Residual = 0.635 |  | 
CCgtAGcCaAAGGCCAgGGg | 
GGgGGG |  | MMP0016 MMP0036 MMP0050 MMP0107 MMP0134 MMP0402 MMP0484 MMP0583 MMP0644 MMP0649 MMP0971 MMP0990 MMP1038 MMP1459 MMP1479 MMP1661 MMP1693 MMP1696 MMP1699 RNA_27 RNA_5 | tfe ribH purB atpH ehaL vhuU vhuD tRNA-Val2 tRNA-Ala2 | hypothetical protein | transcription initiation factor E subunit alpha | 6,7-dimethyl-8-ribityllumazine synthase | sodium/hydrogen exchanger | branched chain amino acid ABC transporter | cation diffusion facilitator family transporter | carbamoyltransferase | adenylosuccinate lyase | A1A0 ATPase, subunit H | F420 non-reducing hydrogenase subunit | F420-non-reducing hydrogenase subunit delta | tRNA-Val | tRNA-Ala |
| 58 | 23 | 57 | 1.037 | | 
Residual = 0.765 |  | 
GaGGtG | 
CACCGTGc |  | MMP0048 MMP0117 MMP0172 MMP0274 MMP0386 MMP0445 MMP0585 MMP0638 MMP0745 MMP0798 MMP1153 MMP1176 MMP1199 MMP1223 MMP1257 MMP1291 MMP1326 MMP1395 MMP1430 MMP1472 MMP1477 RNA_26 RNA_47 | hypE HMmA ehbN rpoN cbiA tRNA-Leu3 rrnB5S | hypothetical protein | hydrogenase expression/formation protein HypE | histone A | UspA domain-containing protein | energy conserving hydrogenase B large subunit | putative iron transport system substrate-binding protein, N-term half | phosphate transporter PhoU | NERD domain protein | glycoside hydrolase family protein | DNA-directed RNA polymerase subunit N | Hef nuclease | cation transporter | cobyrinic acid a,c-diamide synthase | tRNA-Leu | 5S ribosomal RNA |
| 59 | 25 | 57 | -1.103 | | 
Residual = 0.625 |  | 
GGGGGA | 
CGCGTtCCcTTTCtggacgC |  | MMP0130 MMP0194 MMP0232 MMP0241 MMP0306 MMP0335 MMP0445 MMP0701 MMP0710 MMP0753 MMP0785 MMP0854 MMP0863 MMP0913 MMP0961 MMP0963 MMP0987 MMP0996 MMP0997 MMP1248 MMP1256 MMP1291 MMP1636 MMP1637 MMP1648 | fumA transporting dop NifI1 ksgA type1 fwdA | fumarate hydratase | hypothetical protein | oxidoreductase family protein member subunit alpha | ATPase, P-type (transporting), HAD superfamily, subfamily IC | chymotrypsin serine protease | nitrogen regulatory protein P-II | CBS domain-containing protein | MIP family channel protein | dimethyladenosine transferase | blue (type1) copper domain-containing protein | tungsten containing formylmethanofuran dehydrogenase, subunit A | glycoside hydrolase family protein | major facilitator transporter |
| 60 | 25 | 57 | -0.766 | | 
Residual = 0.756 |  | 
gCCCaCCTGAA | 
GccCGAGC |  | MMP0007 MMP0022 MMP0062 MMP0079 MMP0092 MMP0121 MMP0122 MMP0156 MMP0174 MMP0210 MMP0238 MMP0360 MMP0572 MMP0627 MMP0708 MMP0883 MMP0941 MMP1025 MMP1035 MMP1085 MMP1123 MMP1358 MMP1446 MMP1607 MMP1653 | rpoF slyD rpl34e | geranylgeranylglyceryl phosphate synthase-like protein | hypothetical protein | 50S ribosomal protein L31e | orotate phosphoribosyltransferase-like protein | DNA-directed RNA polymerase subunit F | 30S ribosomal protein S19e | HD phosphohydrolase family protein | peptidylprolyl isomerase, FKBP-type | 50S ribosomal protein L34e | radical SAM domain protein | ferredoxin | Zn-finger, ZPR1 type:Zn-finger, ZPR1-related type |
| 61 | 26 | 57 | -0.265 | | 
Residual = 0.723 |  | 
tTGGTGA | 
CggTCTCCAAG |  | MMP0032 MMP0061 MMP0073 MMP0074 MMP0084 MMP0092 MMP0093 MMP0149 MMP0185 MMP0203 MMP0289 MMP0382 MMP0578 MMP0618 MMP0807 MMP0935 MMP1020 MMP1083 MMP1107 MMP1138 MMP1275 MMP1357 MMP1359 MMP1397 MMP1538 MMP1707 | aIF6 argG rpoF mtaP hypD aroQ thiM smc1 aIF2_alpha | transcription regulator ArsR | translation initiation factor IF-6 | argininosuccinate synthase | hypothetical protein | DNA-directed RNA polymerase subunit F | 50S ribosomal protein L21e | putative RNA methylase | 5'-methylthioadenosine phosphorylase | hydrogenase expression/formation protein HypD | putative ATPase RIL | chorismate mutase | carboxymuconolactone decarboxylase related protein | imidazole glycerol phosphate synthase subunit HisF | Signal recognition particle protein SRP19 | hydroxyethylthiazole kinase | thiamineS protein | structural maintenance of chromosome protein | transporter component | translation initiation factor IF-2 subunit alpha |
| 62 | 29 | 56 | -0.460 | | 
Residual = 0.764 |  | 
GGGGGtG | 
CCaCAgGtTCCcCcaCg |  | MMP0076 MMP0097 MMP0105 MMP0244 MMP0338 MMP0353 MMP0424 MMP0488 MMP0605 MMP0632 MMP0678 MMP0757 MMP0804 MMP0840 MMP0956 MMP1011 MMP1118 MMP1128 MMP1129 MMP1172 MMP1228 MMP1276 MMP1282 MMP1303 MMP1429 MMP1600 MMP1646 RNA_16 RNA_5 | topA gltX ppiB rpm glutaminyl transferase tRNA-Ser2 tRNA-Ala2 | deoxyribonuclease | transcriptional regulator | hypothetical protein | UDP-glucose/GDP-mannose dehydrogenase related protein | low molecular weight phosphotyrosine protein phosphatase | putative RNA-processing protein | ATP/GTP-binding motif-containing protein | TetR family transcriptional regulator | DNA topoisomerase I | glutamyl-tRNA synthetase | peptidyl-prolyl cis-trans isomerase, cyclophilin type | DNA protection protein DPS | sensory transduction histidine kinase | transcription factor TFIIS:DNA-directed RNA polymerase, M/15 kDa subunit | ribosomal protein S6 modification enzyme (glutaminyl transferase) related | tRNA-Ser | tRNA-Ala |
| 63 | 24 | 57 | -1.205 | | 
Residual = 0.854 |  | 
tTcCGGTG | 
cTGGGcG |  | MMP0005 MMP0078 MMP0108 MMP0109 MMP0162 MMP0223 MMP0224 MMP0375 MMP0378 MMP0435 MMP0516 MMP0556 MMP0557 MMP0821 MMP0856 MMP0859 MMP0933 MMP1093 MMP1268 MMP1269 MMP1308 MMP1462 MMP1475 MMP1617 | III afuB_1 hemL modD vhcD nifD nifN cheY coaD tal ehaO | hypothetical protein | ABC-type Iron(III)-binding periplasmic protein precursor | ABC-type transporter permease protein | glutamate-1-semialdehyde aminotransferase | radical SAM domain protein | amidohydrolase | quinolinate phosphoribosyl transferase | TatD-related deoxyribonuclease | coenzyme F420-non-reducing hydrogenase subunit delta | nitrogenase alpha chain | nitrogenase | response regulator receiver protein | phosphopantetheine adenylyltransferase | putative translaldolase | energy conserving hydrogenase A large subunit |
| 64 | 29 | 59 | -0.885 | | 
Residual = 0.651 |  | 
TATcTTTGAATTTATgGTGaAA | 
acaaAnTTATAAAnaATataAT |  | MMP0025 MMP0097 MMP0104 MMP0350 MMP0362 MMP0367 MMP0370 MMP0388 MMP0391 MMP0393 MMP0431 MMP0755 MMP1048 MMP1066 MMP1076 MMP1080 MMP1187 MMP1263 MMP1277 MMP1315 MMP1318 MMP1328 MMP1330 MMP1339 MMP1347 MMP1429 MMP1591 MMP1659 MMP1704 | aspC fucA sdhA korG lysS HMmB rpm cbiG pyrB | hypothetical protein | transcriptional regulator | polyferredoxin | hexapeptide repeat-containing transferase | geranylgeranyl reductase | aspartate aminotransferase | phosphodiesterase | rhodopsin-like GPCR superfamily protein | ATP/GTP-binding motif-containing protein | putative molybdenum cofactor biosynthesis protein C | glycosyl transferase, group 1 | class II aldolase/adducin family protein | succinate dehydrogenase flavoprotein subunit | 2-oxoglutarate ferredoxin oxidoreductase subunit gamma | lysyl-tRNA synthetase | enolase | hydrogenase assembly chaperone hypC/hupF | SAM-binding motif-containing protein | histone B | transcription factor TFIIS:DNA-directed RNA polymerase, M/15 kDa subunit | cobalamin (vitamin B12) biosynthesis CbiG protein | aspartate carbamoyltransferase catalytic subunit |
| 65 | 22 | 56 | -1.754 | | 
Residual = 0.676 |  | 
gGGGGGA | 
GcTTCGtGgaAcGGGgcGC |  | MMP0111 MMP0237 MMP0283 MMP0286 MMP0304 MMP0306 MMP0480 MMP0497 MMP0535 MMP0546 MMP0622 MMP0635 MMP0683 MMP0709 MMP0785 MMP0851 MMP0988 MMP1256 MMP1423 MMP1450 MMP1590 MMP1703 | ndk ftsY dop ehaC | hypothetical protein | nucleoside-diphosphate kinase | N-glycosylase/DNA lyase | oxidoreductase family protein member subunit alpha | AMMECR1 domain protein | ADP-ribosylation/crystallin J1 | ABC transporter ATPase | signal recognition particle-docking protein FtsY | chymotrypsin serine protease | RNA methyltransferase related protein | galdehyde dehydrogenase | ExsB family protein |
| 66 | 13 | 57 | -3.469 | | 
Residual = 0.390 |  | 
TCCCCC | 
GCCGcGTTC |  | MMP0600 MMP0614 MMP0629 MMP0720 MMP0914 MMP1154 MMP1155 MMP1156 MMP1157 MMP1158 MMP1159 MMP1160 MMP1161 | hdrC1 hdrB1 rbo | hypothetical protein | iron-sulfur flavoprotein | hydroxylamine reductase | heterosulfide reductase, subunit C1 | heterosulfide reductase, subunit B1 | carboxymuconolactone decarboxylase | desulfoferrodoxin, ferrous iron-binding site | Ferritin |
| 67 | 25 | 57 | -1.110 | | 
Residual = 0.878 |  | 
AngGTTanAAAaTnAAaAaagcA | 
GCAGgAaGGgccGCAGgTG |  | MMP0008 MMP0118 MMP0123 MMP0147 MMP0150 MMP0156 MMP0265 MMP0582 MMP0676 MMP0696 MMP0707 MMP0862 MMP0884 MMP0941 MMP1103 MMP1162 MMP1230 MMP1235 MMP1254 MMP1352 MMP1368 MMP1398 MMP1455 MMP1464 MMP1551 | DP1 purT proS yodP moaE purM dapE ehaH ehaQ ffh | DNA polymerase II small subunit | beta-lactamase domain protein | phosphoribosylglycinamide formyltransferase 2 | nitrogenase reductase-like protein | hypothetical protein | 30S ribosomal protein S19e | AzlC family protein | intermediate filament protein | prolyl-tRNA synthetase | sodium/hydrogen exchanger | GCN5-related N-acetyltransferase | DNA polymerase, beta-like region | molybdopterin biosynthesis MoaE | phosphoribosylaminoimidazole synthetase | ribulose-1,5-biphosphate synthetase | 30S ribosomal protein S7P | diaminopimelate aminotransferase | putative transmembrane subunit of a hydrogenase | signal recognition particle protein Srp54 |
| 68 | 36 | 64 | 1.256 | | 
Residual = 0.444 |  | 
GgCCttgGccTttggctnGggtCG | 
CAGcGtGGGGc |  | MMP0151 MMP0246 MMP0302 MMP0303 MMP0441 MMP0447 MMP0461 MMP0468 MMP0575 MMP0592 MMP0674 MMP0724 MMP0731 MMP0736 MMP0843 MMP0962 MMP1000 MMP1283 MMP1290 MMP1329 MMP1331 MMP1338 MMP1378 MMP1569 MMP1685 MMP1687 MMP1693 MMP1699 Mma-sR06 RNA_1 RNA_15 RNA_25 RNA_27 RNA_28 RNA_35 RNA_8 | rpl40e Cys rpoE2 gatC korD vhuU tRNA-Ala2 tRNA-Arg3 tRNA-His1 tRNA-Val2 tRNA-Cys1 tRNA-Thr2 | 50S ribosomal protein L40e | hypothetical protein | rubredoxin-type Fe(Cys)4 protein | DNA-directed RNA polymerase subunit E | nitrogenase related protein | aspartyl/glutamyl-tRNA amidotransferase subunit C | helix-turn-helix DNA binding protein | exodeoxyribonuclease VII small subunit | PRC-barrel domain protein | zinc finger protein | GTP-binding protein | ferredoxin | 2-oxoglutarate ferredoxin oxidoreductase, delta (ferredoxin) subunit | F420 non-reducing hydrogenase subunit | tRNA-Ala | tRNA-Arg | tRNA-His | tRNA-Val | tRNA-Cys | tRNA-Thr |
| 69 | 28 | 57 | -0.066 | | 
Residual = 0.766 |  | 
TgGGGtGnaAC | 
TGGtTTaAAAaaTaAgcagaTGgA |  | MMP0005 MMP0134 MMP0163 MMP0195 MMP0322 MMP0328 MMP0469 MMP0491 MMP0504 MMP0510 MMP0565 MMP0567 MMP0652 MMP0735 MMP0741 MMP0752 MMP0765 MMP0787 MMP0832 MMP0887 MMP0930 MMP1130 MMP1184 MMP1220 MMP1332 MMP1333 RNA_10 RNA_33 | arsA rfcB modC fmdC cheR glgP aroC tRNA-Arg1 tRNA-Met3 | hypothetical protein | arsenite-activated ATPase ArsA | replication factor C large subunit | MotA/TolQ/ExbB proton channel | molybdenum ABC transporter ATP-binding protein | molybdenum containing formylmethanofuran dehydrogenase subunit C | N-6 adenine-specific DNA methylase:N6 adenine-specific DNA methyltransferase, D12 class | MarR family transcriptional regulator | ferredoxin | stress responsive alpha-beta barrel domain protein | chemotaxis protein CheR | N-acetyltransferase related protein | alpha-glucan phosphorylase | FAD-dependent pyridine nucleotide-disulphide oxidoreductase | chorismate synthase | tRNA-Arg | tRNA-Met |
| 70 | 21 | 56 | -0.781 | | 
Residual = 0.657 |  | 
GGTgATTT | 
TGcGGC |  | MMP0014 MMP0052 MMP0394 MMP0414 MMP0586 MMP0589 MMP0597 MMP0894 MMP0900 MMP1021 MMP1106 MMP1363 MMP1369 MMP1415 MMP1427 MMP1474 MMP1516 MMP1525 MMP1527 MMP1570 MMP1594 | truD hemD thrS flpA guaA rpoA1 aEF-2 rpl6p ileS | tRNA pseudouridine synthase D | putative signal transduction protein with CBS domains | uroporphyrinogen III synthase | threonyl-tRNA synthetase | uncharacterized endonuclease III related protein | radical SAM domain protein | fibrillarin | GMP synthase subunit B | rhodanese domain protein | hypothetical protein | DNA-directed RNA polymerase subunit A' | elongation factor EF-2 | 50S ribosomal protein L6P | isoleucyl-tRNA synthetase | modulator of DNA gyrase | aspartate aminotransferase | hydrolase, TatD family |
| 71 | 27 | 56 | 0.078 | | 
Residual = 0.681 |  | 
TCtCGCCAatC | 
tTanTaTTTTAAaag |  | MMP0021 MMP0054 MMP0225 MMP0491 MMP0609 MMP0611 MMP0615 MMP0726 MMP0752 MMP0802 MMP0838 MMP0945 MMP1017 MMP1082 MMP1170 MMP1176 MMP1189 MMP1197 MMP1375 MMP1488 MMP1630 MMP1638 MMP1682 MMP1686 Mma-sR05 Mma-sR09 RNA_24 | gldA pth2 lysC hisH recJ cbf5 tRNA-Leu2 | hypothetical protein | glycerol dehydrogenase | MotA/TolQ/ExbB proton channel | peptidyl-tRNA hydrolase | Beta-lactamase-like | Iron-containing alcohol dehydrogenase | glyceraldehyde-3-phosphate ferredoxin oxidoreductase | aspartate kinase | imidazole glycerol phosphate synthase subunit HisH | glycosyl transferase family protein | putative iron transport system substrate-binding protein, N-term half | ribose-5-phosphate isomerase A | binding-protein-dependent transport systems inner membrane component | SAM-binding motif-containing protein | modulator of DNA gyrase | ABC transporter ATPase | MoaA/nifB/pqqE family protein | single stranded DNA-specific exonuclease | H/ACA RNA-protein complex component Cbf5p | tRNA-Leu |
| 72 | 31 | 58 | 0.337 | | 
Residual = 0.753 |  | 
cGCtgGGCTCATAACCcaGtGaTC | 
aggGGTtCaaatcCCncCGggtCc |  | MMP0485 MMP0538 MMP0664 MMP0760 MMP0764 MMP0816 MMP0869 MMP0968 MMP1185 MMP1373 MMP1423 MMP1452 MMP1463 MMP1468 MMP1477 MMP1540 MMP1565 MMP1568 MMP1598 MMP1682 MMP1684 RNA_11 RNA_18 RNA_23 RNA_24 RNA_29 RNA_34 RNA_36 RNA_40 RNA_47 RNA_9 | hisD purP ehaE ehaP cbiA or900 recJ tRNA-Glu1 tRNA-Ile1 tRNA-Glu2 tRNA-Leu2 tRNA-Gly1 tRNA-Met4 tRNA-Ala2 rrnB23S rrnB5S | hypothetical protein | seryl-tRNA synthetase related | cytidine/deoxycytidylate deaminase, zinc-binding region related protein | histidinol dehydrogenase | hydrogen uptake protein:hydrogenase maturation protease HycI | 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase | galdehyde dehydrogenase | polyferredoxin | cobyrinic acid a,c-diamide synthase | tetrahydromethanopterin S-methyltransferase subunit A | single stranded DNA-specific exonuclease | metallophosphoesterase | tRNA-Glu | tRNA-Ile | tRNA-Leu | tRNA-Gly | tRNA-Met | tRNA-Ala | 23S ribosomal RNA | 5S ribosomal RNA |
| 73 | 27 | 56 | -1.877 | | 
Residual = 0.809 |  | 
aAtnTAaTtTTtAA | 
CGAGCGCgTCcg |  | MMP0132 MMP0178 MMP0262 MMP0381 MMP0532 MMP0555 MMP0603 MMP0621 MMP0647 MMP0665 MMP0845 MMP0850 MMP0885 MMP0935 MMP0994 MMP1015 MMP1029 MMP1030 MMP1037 MMP1050 MMP1076 MMP1124 MMP1131 MMP1532 MMP1588 MMP1701 MMP1710 | purQ flaK aIF-1A potE pgk serA | branched-chain amino acid aminotransferase | phosphoribosylformylglycinamidine synthase I | hypothetical protein | 3-isopropylmalate dehydratase, small subunit | preflagellin peptidase | translation initiation factor IF-1A | xylose isomerase domain protein TIM barrel | amino acid transporter | ATP/GTP-binding motif-containing protein | transcription factor CBF/NF-Y | hexapeptide repeat-containing transferase | thiamine-monophosphate kinase | peptide chain release factor 1 | phosphoglycerate kinase | D-3-phosphoglycerate dehydrogenase | amino acid-binding ACT domain protein |
| 74 | 19 | 57 | -1.447 | | 
Residual = 0.837 |  | 
GAAaatCttGAAAAAggAG | 
cGgAGGGg |  | MMP0052 MMP0060 MMP0069 MMP0072 MMP0133 MMP0145 MMP0314 MMP0518 MMP0573 MMP0668 MMP0704 MMP0706 MMP0717 MMP0815 MMP0844 MMP1367 MMP1631 MMP1640 MMP1680 | guaB hpt mobA rps12P glmS | putative signal transduction protein with CBS domains | ribosomal LX protein | methylated-DNA--protein-cysteine methyltransferase | hypothetical protein | inosine-5'-monophosphate dehydrogenase | adenine phosphoribosyltransferase | coenzyme F390 synthetase | putative molybdopterin-guanine dinucleotide biosynthesis protein A | ParA type ATPase | NAD binding site:UDP-glucose/GDP-mannose dehydrogenase | 30S ribosomal protein S12P | PA-phosphatase related phosphoesterase | S-adenosylmethionine synthetase | glucosamine--fructose-6-phosphate aminotransferase |
| 75 | 28 | 57 | -1.805 | | 
Residual = 0.633 |  | 
ATTTtTgGgttGAataAtaTaAAA | 
CaAAatgCGgtgAGA |  | MMP0029 MMP0109 MMP0224 MMP0233 MMP0291 MMP0311 MMP0448 MMP0623 MMP0686 MMP0788 MMP0909 MMP1094 MMP1236 MMP1394 MMP1422 MMP1446 MMP1448 MMP1449 MMP1451 MMP1452 MMP1453 MMP1457 MMP1460 MMP1471 MMP1521 MMP1584 MMP1618 MMP1702 | afuB_1 hemL ppsA aroD secY ehaA ehaB ehaD ehaE ehaF ehaJ ehaM aIF-2B_I hom | hypothetical protein | ABC-type transporter permease protein | glutamate-1-semialdehyde aminotransferase | hydrogenase expression/formation protein related | fructose-bisphosphate aldolase | phosphoenolpyruvate synthase | 3-dehydroquinate dehydratase (Type I DHQase) | preprotein translocase subunit SecY | Zn-finger, ZPR1 type:Zn-finger, ZPR1-related type | energy conserving hydrogenase A integral membrane subunit | spermidine synthase | transcription initiation factor 2B subunit I | homoserine dehydrogenase |
| 76 | 17 | 57 | -1.613 | | 
Residual = 0.520 |  | 
tTAactTTtGgGgTG | 
CTGgGG |  | MMP0029 MMP0227 MMP0237 MMP0239 MMP0344 MMP0593 MMP0614 MMP1377 MMP1382 MMP1447 MMP1541 MMP1567 MMP1609 MMP1691 MMP1695 MMP1715 MMP1720 | nrdD fruA mtrH ftr fwdB vhuG | hypothetical protein | anaerobic ribonucleoside-triphosphate reductase | walker type ATPase | iron-sulfur flavoprotein | coenzyme F420-reducing hydrogenase subunit alpha | Cro repressor family protein | tetrahydromethanopterin S-methyltransferase subunit H | formylmethanofuran--tetrahydromethanopterin formyltransferase | tungsten containing formylmethanofuran dehydrogenase subunit B | F420-non-reducing hydrogenase subunit | small GTP-binding protein |
| 77 | 28 | 56 | -2.019 | | 
Residual = 0.961 |  | 
GGGGGATA | 
ATccATGaatGgtgTAattaatAG |  | MMP0153 MMP0271 MMP0277 MMP0280 MMP0430 MMP0479 MMP0492 MMP0581 MMP0601 MMP0612 MMP0778 MMP0827 MMP0844 MMP0850 MMP0869 MMP0961 MMP0977 MMP0995 MMP0997 MMP1003 MMP1067 MMP1195 MMP1208 MMP1289 MMP1294 MMP1310 MMP1362 MMP1553 | aksA hisI LigT potE CooC type1 trpB yneG aIF2_gamma rpl10e glgA purO rpoB1 rdxA | trans-homoaconitate synthase | ATP binding putative nickel incorporation protein | TraB family protein | phosphoribosyl-AMP cyclohydrolase | ribonuclease P | hypothetical protein | 2'-5' RNA ligase | amino acid transporter | cytidine/deoxycytidylate deaminase, zinc-binding region related protein | CO dehydrogenase maturation factor | blue (type1) copper domain-containing protein | tryptophan synthase subunit beta | succinate dehydrogenase/fumarate reductase iron-sulfur subunit | putative cytoplasmic protein | translation initiation factor IF-2 subunit gamma | 50S ribosomal protein L10e | starch synthase | IMP cyclohydrolase | DNA-directed RNA polymerase subunit B' | nitroreductase family protein |
| 78 | 14 | 57 | -2.041 | | 
Residual = 0.709 |  | 
GAGGGG | 
GGaAGGGg |  | MMP0041 MMP0335 MMP0490 MMP0719 MMP0908 MMP1053 MMP1054 MMP1246 MMP1247 MMP1249 MMP1608 MMP1691 MMP1692 MMP1694 | tfb hdrB2 hdrC2 fwdG fwdD fwdC fwdB vhuB vhuA | transcription initiation factor IIB | hypothetical protein | transcriptional regluator | CBS domain-containing protein | heterodisulfide reductase; subunit B2 | heterodisulfide reductase; subunit C2 | tungsten containing formylmethanofuran dehydrogenase, subunit G | tungsten containing formylmethanofuran dehydrogenase, subunit D | tungsten containing formylmethanofuran dehydrogenase, subunit C | tungsten containing formylmethanofuran dehydrogenase subunit B | polyferredoxin, associated with F420-non-reducing hydrogenase | F420-non-reducing hydrogenase subunit alpha |
| 79 | 21 | 57 | -1.310 | | 
Residual = 0.557 |  | 
GaatAcaCGGagGAg | 
AaGGcTTCcAagtG |  | MMP0518 MMP0541 MMP0648 MMP0676 MMP0815 MMP0910 MMP0946 MMP1002 MMP1108 MMP1312 MMP1313 MMP1315 MMP1364 MMP1367 MMP1396 MMP1432 MMP1445 MMP1460 MMP1465 MMP1485 MMP1612 | serB rtcA gatB trpA corA fen-1 korG rpoA2 rps12P purA guaA ehaM ehaR moaB | hypothetical protein | phosphoserine phosphatase SerB | RNA 3'-terminal-phosphate cyclase | intermediate filament protein | aspartyl/glutamyl-tRNA amidotransferase subunit B | tryptophan synthase subunit alpha | magnesium/cobalt transporter CorA | flap endonuclease-1 | 2-oxoglutarate ferredoxin oxidoreductase subunit gamma | DNA-directed RNA polymerase subunit A'' | 30S ribosomal protein S12P | aminotransferase | adenylosuccinate synthetase | GMP synthase subunit A | molybdenum cofactor biosynthesis protein |
| 80 | 12 | 57 | -1.946 | | 
Residual = 0.444 |  | 
TgGaGGTG | 
GAGTTCTG |  | MMP0066 MMP0680 MMP0689 MMP1382 MMP1384 MMP1644 MMP1683 MMP1695 MMP1697 MMP1714 MMP1715 MMP1716 | glnB upp fruA fruG vhuG hdrA hmdII | nitrogen regulatory protein P-II | uracil phosphoribosyltransferase | xanthine/uracil permease family protein | coenzyme F420-reducing hydrogenase subunit alpha | coenzyme F420-reducing hydrogenase subunit gamma | hypothetical protein | F420-non-reducing hydrogenase subunit | heterodisulfide reductase, subunit A | roadblock/LC7 family protein | small GTP-binding protein | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase-related protein |
| 81 | 28 | 56 | -0.272 | | 
Residual = 0.668 |  | 
GGgGGTGG | 
gTTTTTTAaAt |  | MMP0049 MMP0053 MMP0103 MMP0126 MMP0200 MMP0207 MMP0223 MMP0233 MMP0299 MMP0333 MMP0448 MMP0582 MMP0593 MMP0623 MMP0685 MMP0870 MMP0877 MMP1028 MMP1094 MMP1220 MMP1373 MMP1499 MMP1574 MMP1587 MMP1628 MMP1654 MMP1683 MMP1698 | bioB fmdE modC nadC ppsA glgP purP bioF ehbF | carbonic anhydrase | hypothetical protein | pyridoxal biosynthesis lyase PdxS | biotin synthase | molybdenum containing formylmethanofuran dehydrogenase, subunit E | molybdenum ABC transporter ATP-binding protein | AzlC family protein | walker type ATPase | N-6 adenine-specific DNA methylase | glycerate dehydrogenase | quinolinate phosphoribosyl transferase:nicotinate-nucleotide pyrophosphorylase | phosphoenolpyruvate synthase | alpha-glucan phosphorylase | 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase | 8-amino-7-oxononanoate synthase | hydrogenase subunit F |
| 82 | 26 | 58 | -0.458 | | 
Residual = 0.563 |  | 
gGCtTTGGCGG | 
CGAGCGCaTCcg |  | MMP0079 MMP0121 MMP0180 MMP0231 MMP0259 MMP0312 MMP0330 MMP0595 MMP0598 MMP0621 MMP0626 MMP0627 MMP0667 MMP0837 MMP0845 MMP0909 MMP0911 MMP0916 MMP1015 MMP1016 MMP1025 MMP1250 MMP1615 MMP1638 MMP1653 MMP1702 | ribC rplP0 cbiC cmk rpl34e rps2P hom | orotate phosphoribosyltransferase-like protein | hypothetical protein | riboflavin synthase | cysteine-rich small domain | acidic ribosomal protein P0 | precorrin-8X methylmutase | phosphoglycerate mutase-related | xylose isomerase domain protein TIM barrel | cytidylate kinase | 50S ribosomal protein L34e | 30S ribosomal protein S2 | ribonuclease H | iron-sulfur flavoprotein | PRC-barrel domain protein | transcription factor CBF/NF-Y | putative signal transduction protein with CBS domains | 6-pyruvoyl tetrahydropterin synthase | MoaA/nifB/pqqE family protein | homoserine dehydrogenase |
| 83 | 21 | 58 | -0.590 | | 
Residual = 0.742 |  | 
CTGGGgG | 
cGGAaTTCaggG |  | MMP0129 MMP0138 MMP0180 MMP0209 MMP0258 MMP0311 MMP0373 MMP0379 MMP0380 MMP0387 MMP0635 MMP0638 MMP0647 MMP0695 MMP1079 MMP1451 MMP1457 MMP1491 MMP1618 MMP1647 RNA_19 | fdhA ribC rpl12p dnaB psmB ehaD ehaJ trzA aIF-2B_I psmR tRNA-Met1 | hypothetical protein | formate dehydrogenase alpha subunit | riboflavin synthase | 50S ribosomal protein L12P | DNA polymerase family B protein | microsomal signal peptidase 21 KD subunit | ABC transporter ATPase | proteasome, subunit beta | glycosyl transferase family protein | energy conserving hydrogenase A integral membrane subunit | amidohydrolase | transcription initiation factor 2B subunit I | proteasome-activating nucleotidase | tRNA-Met |
| 84 | 27 | 57 | -0.384 | | 
Residual = 0.825 |  | 
AgGGGGTG | 
CcCgAtATGggtTTT |  | MMP0065 MMP0068 MMP0102 MMP0114 MMP0171 MMP0196 MMP0293 MMP0366 MMP0375 MMP0393 MMP0506 MMP0550 MMP0563 MMP0680 MMP0772 MMP0791 MMP0794 MMP0813 MMP1177 MMP1334 MMP1340 MMP1377 MMP1442 MMP1486 MMP1518 MMP1633 MMP1698 | amtB pcm III modB upp mre11 | ammonium transporter | protein-L-isoaspartate O-methyltransferase | xylose isomerase domain protein TIM barrel | hypothetical protein | ABC-type iron(III) transport system, periplasmic binding protein | aldolase | radical SAM domain protein | phosphodiesterase | NifC-like ABC-type porter | amino acid ABC transporter periplasmic protein | uracil phosphoribosyltransferase | TetR family transcriptional regulator Member | putative iron transport system substrate-binding protein, C-term half | solute-binding protein/glutamate receptor | SbcD/Mre11 family DNA repair exonuclease | transcription regulator ArsR | MscS mechanosensitive ion channel | sulfate/molybdate ABC-transporter homolog, ATPase subunit |
| 85 | 26 | 57 | -1.529 | | 
Residual = 0.831 |  | 
TATTTTgTagGGGGg | 
AAcaTCGcGgGTgGTtGGAAA |  | MMP0168 MMP0444 MMP0474 MMP0479 MMP0519 MMP0550 MMP0554 MMP0619 MMP0700 MMP0711 MMP0838 MMP0957 MMP1003 MMP1007 MMP1009 MMP1075 MMP1091 MMP1165 MMP1218 MMP1225 MMP1273 MMP1478 MMP1604 MMP1605 MMP1711 MMP1712 | corA dsbD trpB trpD pyrC dut vorC cbiA pcnA | ParR family transcriptional regulator | 30S ribosomal protein S27ae | hypothetical protein | amino acid ABC transporter periplasmic protein | SAM-binding motif-containing protein | magnesium/cobalt transporter CorA | tryptophan synthase subunit beta | anthranilate phosphoribosyltransferase | dihydroorotase | dUTP diphosphatase | ADP-glucose pyrophosphorylase | heavy metal translocating P-type ATPase | amino acid ABC-type transporter related protein | 2-oxoisovalerate oxidoreductase subunit gamma | cobyrinic acid a,c-diamide synthase:cobyrinic acid a,c-diamide synthase CbiA | pyruvate kinase | proliferating cell nuclear antigen | LysR family transcriptional regulator |
| 86 | 23 | 55 | 0.212 | | 
Residual = 0.720 |  | 
GCGAGGTGCG | 
GTCATATGGTGCTATATGGAGG |  | MMP0011 MMP0361 MMP0424 MMP0494 MMP0604 MMP0684 MMP0751 MMP0839 MMP0986 MMP1091 MMP1148 MMP1149 MMP1151 MMP1214 MMP1215 MMP1242 MMP1290 MMP1370 MMP1479 MMP1686 MMP1688 MMP1709 RNA_39 | hsp20 thyA Sm protein leuC mtbC nadA aEF-1_alpha cbf5 rpl44e rrnA16S | DNA-cytosine methyltransferase | hypothetical protein | helicase family protein | heat shock protein Hsp20 | thymidylate synthase | ADP-glucose pyrophosphorylase | small nuclear ribonucleoprotein (Sm protein) | 3-isopropylmalate dehydratase | coenzyme B12-binding:cobalamin-dependent methionine synthase, B12-binding | cobyric acid synthase | quinolinate synthetase | GTP-binding protein | elongation factor 1-alpha | H/ACA RNA-protein complex component Cbf5p | 50S ribosomal protein L44e | 16S ribosomal RNA |
| 87 | 26 | 57 | 1.284 | | 
Residual = 0.801 |  | 
TCCCnCcGGg | 
cGAGTaCcaCCCcG |  | MMP0117 MMP0142 MMP0174 MMP0200 MMP0494 MMP0523 MMP0570 MMP0642 MMP0660 MMP0711 MMP0746 MMP0755 MMP0871 MMP0877 MMP0927 MMP1059 MMP1136 MMP1140 MMP1296 MMP1327 MMP1504 MMP1643 MMP1713 RNA_16 RNA_34 RNA_50 | fmdE apt corA nadC cheA fdxA pfkC rpoK porB tRNA-Ser2 tRNA-Met4 tRNA-SeC1 | hypothetical protein | thiamine pyrophosphate dependent enzyme related to acetolactate synthase | HD phosphohydrolase family protein | molybdenum containing formylmethanofuran dehydrogenase, subunit E | helicase family protein | ABC transporter ATP-binding protein | adenine phosphoribosyltransferase | magnesium/cobalt transporter CorA | ATP/GTP-binding motif-containing protein | quinolinate phosphoribosyl transferase:nicotinate-nucleotide pyrophosphorylase | CheA signal transduction histidine kinase | rubrerythrin | ferredoxin | ADP-specific phosphofructokinase | RNA polymerase Rpb6 | pyruvate ferredoxin oxidoreductase subunit beta | tRNA-Ser | tRNA-Met | tRNA-Sec |
| 88 | 26 | 57 | -0.411 | | 
Residual = 0.685 |  | 
TcAATTTTAAAAACg | 
CGGTGG |  | MMP0047 MMP0053 MMP0055 MMP0077 MMP0125 MMP0126 MMP0135 MMP0211 MMP0432 MMP0433 MMP0694 MMP0713 MMP1014 MMP1103 MMP1107 MMP1108 MMP1116 MMP1121 MMP1142 MMP1236 MMP1251 MMP1358 MMP1521 MMP1528 MMP1530 MMP1628 | flpA bioB thrC iorA2 corA pheA ehbF | radical SAM domain protein | hypothetical protein | fibrillarin-like protein | biotin synthase | threonine synthase | TatD-related deoxyribonuclease | putative flavodoxin | beta-lactamase-like protein | indolepyruvate oxidoreductase subunit alpha 2 | Signal recognition particle protein SRP19 | magnesium/cobalt transporter CorA | cellulase | metal-dependent phophohydrolase related protein | metallophosphoesterase | putative signal-transduction protein with CBS domains | ferredoxin | prephenate dehydratase | hydrogenase subunit F |
| 89 | 24 | 56 | -0.518 | | 
Residual = 0.796 |  | 
AAtTtAAAaAa | 
GGGcGG |  | MMP0234 MMP0235 MMP0398 MMP0501 MMP0516 MMP0547 MMP0589 MMP0810 MMP0830 MMP0831 MMP0835 MMP0896 MMP0951 MMP1132 MMP1133 MMP1171 MMP1209 MMP1259 MMP1387 MMP1462 MMP1508 MMP1639 MMP1677 MMP1713 | modD mtaA mtbA cobD endA comC pssA ehaO S | hypothetical protein | quinolinate phosphoribosyl transferase | RecJ related protein | radical SAM domain protein | uroporphyrinogen decarboxylase | methylcobalamin:coenzyme M methyltransferase | polysaccharide biosynthesis protein | cobalamin biosynthesis protein | tRNA-splicing endonuclease subunit alpha | L-sulfolactate dehydrogenase/(S)-hydroxyglutaric acid dehydrogenase | CDP-diacylglycerol--serine O-phosphatidyltransferase | FAD-dependent pyridine nucleotide-disulphide oxidoreductase | energy conserving hydrogenase A large subunit | phosphomethylpyrimidine kinase | (S)-2,3-di-O-geranylgeranylglyceryl phosphate synthase |
| 90 | 27 | 56 | 0.001 | | 
Residual = 0.850 |  | 
GGGGGA | 
CAcCCCcC |  | MMP0240 MMP0354 MMP0415 MMP0454 MMP0496 MMP0547 MMP0548 MMP0690 MMP0703 MMP0760 MMP0810 MMP0811 MMP0820 MMP0860 MMP0951 MMP1006 MMP1058 MMP1110 MMP1126 MMP1132 MMP1222 MMP1270 MMP1524 MMP1565 Mma-sR04 RNA_46 RNA_7 | hisB frcA nifX cobD trpE endA radA secF or900 rrnA5S tRNA-Ala2 | hypothetical protein | putative oligosaccharide transporter | O-sialoglycoprotein endopeptidase/protein kinase | glutamate synthase subunit-related | RecJ related protein | imidazoleglycerol-phosphate dehydratase | polyferredoxin | coenzyme F420-reducing hydrogenase subunit alpha | nitrogen fixation-related protein | cobalamin biosynthesis protein | anthranilate synthase component I | putative proliferating-cell nucleolar antigen | tRNA-splicing endonuclease subunit alpha | DNA repair and recombination protein RadA | bifunctional hexulose-6-phosphate synthase/ribonuclease regulator | preprotein translocase subunit SecF | tetrahydromethanopterin S-methyltransferase subunit A | 5S ribosomal RNA | tRNA-Ala |
| 91 | 19 | 58 | -1.208 | | 
Residual = 0.532 |  | 
TgGGAGGG | 
GgCCGATGc |  | MMP0020 MMP0042 MMP0163 MMP0285 MMP0756 MMP0817 MMP0972 MMP1053 MMP1054 MMP1163 MMP1224 MMP1261 MMP1384 MMP1556 MMP1557 MMP1559 MMP1561 MMP1608 MMP1644 | arsA frcB hdrB2 hdrC2 fruG mcrD mcrC mcrA mtrD | nickel responsive regulator | H/ACA RNA-protein complex component Gar1 | arsenite-activated ATPase ArsA | TrkA-N domain protein | hypothetical protein | coenzyme F420-reducing hydrogenase subunit beta | heterodisulfide reductase; subunit B2 | heterodisulfide reductase; subunit C2 | CutA1 divalent ion tolerance protein | ABC-type amino acid transport/signal transduction systems periplasmic component-related | coenzyme F420-reducing hydrogenase subunit gamma | methyl-coenzyme M reductase I, protein D | methyl coenzyme M reductase I, protein C | methyl-coenzyme M reductase I, alpha subunit | tetrahydromethanopterin S-methyltransferase subunit D |
| 92 | 32 | 57 | -0.239 | | 
Residual = 0.624 |  | 
cCcTAAATTaAtAtTTnaAAc | 
ACcAGAGGtG |  | MMP0010 MMP0051 MMP0087 MMP0096 MMP0182 MMP0351 MMP0356 MMP0357 MMP0359 MMP0362 MMP0367 MMP0391 MMP0396 MMP0401 MMP0532 MMP0705 MMP0865 MMP0921 MMP0966 MMP1078 MMP1084 MMP1126 MMP1192 MMP1195 MMP1201 MMP1202 MMP1203 MMP1238 MMP1266 MMP1485 MMP1582 MMP1710 | hisE hmgA aspB-like1 aspC eno metE wbpI subgroup II cobA yneG cbiD bioB Gln moaB pdaD | hypothetical protein | phosphoribosyl-ATP pyrophosphatase | hydroxymethylglutaryl-coenzyme A reductase:3-hydroxy-3-methylglutaryl coenzyme A reductase | putative transcriptional regulator, GntR family | DegT/DnrJ/EryC1/StrS aminotransferase | glycosyl transferase, group 1 | UDP-N-acetylglucosamine 2-epimerase | glycosyl transferase family protein | aspartate aminotransferase | enolase | methionine synthase | aminotransferase (subgroup II) adenosylmethionine-8-amino-7-oxononanoate aminotransferase | RNAse P, Rpr2/Rpp21 subunit | uroporphyrin-III C-methyltransferase | putative proliferating-cell nucleolar antigen | radical SAM domain protein | putative cytoplasmic protein | nuclease | cobalt-precorrin-6A synthase | biotin synthase | glutamyl-tRNA(Gln) amidotransferase subunit D | molybdenum cofactor biosynthesis protein | pyruvoyl-dependent arginine decarboxylase |
| 93 | 19 | 56 | -0.611 | | 
Residual = 0.641 |  | 
CCgTGTCG | 
CACCGTG |  | MMP0122 MMP0161 MMP0175 MMP0176 MMP0261 MMP0263 MMP0265 MMP0336 MMP0419 MMP0667 MMP0866 MMP0867 MMP0920 MMP1112 MMP1114 MMP1117 MMP1201 MMP1530 MMP1722 | comB tyrS hjc rps2P proX ahcY rpe hisF | hypothetical protein | 2-phosphosulfolactate phosphatase | cell division protein CDC48 | DNA directed RNA polymerase; subunit L | tyrosyl-tRNA synthetase | Holliday junction resolvase | sodium:neurotransmitter symporter | 30S ribosomal protein S2 | substrate-binding region of ABC-type glycine betaine transport system | binding-protein-dependent transport systems inner membrane component | S-adenosyl-L-homocysteine hydrolase | Pentose-5-phosphate 3-epimerase | nuclease | imidazole glycerol phosphate synthase subunit HisF |
| 94 | 23 | 57 | -1.320 | | 
Residual = 0.749 |  | 
ttGGGGGAtTT | 
CAgcCcGTGCC |  | MMP0030 MMP0031 MMP0299 MMP0456 MMP0470 MMP0531 MMP0591 MMP0599 MMP0725 MMP0761 MMP0803 MMP0842 MMP0988 MMP1024 MMP1066 MMP1123 MMP1225 MMP1449 MMP1458 MMP1519 MMP1578 MMP1599 MMP1703 | xerD-like cbiJ ehaB ehaK trkA | MCM family DNA replication protein | hypothetical protein | Phage integrase | MCE family-like protein | precorrin-6x reductase CbiJ/CobK | putative integral membrane protein | RNA methyltransferase related protein | putative molybdenum cofactor biosynthesis protein C | radical SAM domain protein | amino acid ABC-type transporter related protein | anion transport system permease protein | nicotinamide-nucleotide adenylyltransferase | TrkA-N domain protein |
| 95 | 30 | 57 | -0.510 | | 
Residual = 0.612 |  | 
AaATngtAAgnTATATATanTT | 
GTTAGGTTTGCTAACGTTATC |  | MMP0148 MMP0164 MMP0165 MMP0166 MMP0270 MMP0272 MMP0273 MMP0348 MMP0557 MMP0558 MMP0580 MMP0631 MMP0780 MMP0825 MMP0852 MMP0976 MMP0980 MMP0981 MMP0983 MMP1063 MMP1178 MMP1243 MMP1245 MMP1380 MMP1481 MMP1500 MMP1502 MMP1504 MMP1505 MMP1506 | acsA cbiX(s) comA act hdrA cdh cdhD cdhB leuA fwdF cbiM ftsz2 porF porB porA porD | acetyl-CoA synthetase, AMP-forming | sirohydrochlorin cobaltochelatase | ABC transporter | MATE family drug/sodium antiporter | Fe-S cluster domain protein | ABC transporter ATPase | phosphosulfolactate synthase | GPR1/FUN34/yaaH family protein | hypothetical protein | anaerobic ribonucleoside-triphosphate reductase activating protein | putatuve iron dependent repressor | heterodisulfide reductase subunit A | acetyl-CoA decarbonylase/synthase complex subunit gamma | acetyl-CoA decarbonylase/synthase complex subunit delta | acetyl-CoA decarbonylase/synthase complex subunit beta | 2-isopropylmalate synthase | periplasmic binding protein | UBA/THIF-type NAD/FAD binding protein | tungsten containing formylmethanofuran dehydrogenase, subunit F | chlorohydrolase | cobalt transport protein CbiM | cell division protein FtsZ | pyruvate ferredoxin oxidoreductase subunit beta | pyruvate oxidoreductase (synthase) subunit alpha | pyruvate oxidoreductase (synthase) subunit delta |
| 96 | 35 | 57 | 0.063 | | 
Residual = 0.764 |  | 
AcccgAtTttttaaatTtTTt | 
CaGccaCAngtgCCaCnacGG |  | MMP0062 MMP0070 MMP0086 MMP0098 MMP0100 MMP0103 MMP0129 MMP0186 MMP0325 MMP0352 MMP0439 MMP0528 MMP0538 MMP0542 MMP0543 MMP0551 MMP0608 MMP0742 MMP0749 MMP0762 MMP0764 MMP0964 MMP1006 MMP1012 MMP1300 MMP1379 MMP1487 MMP1488 MMP1528 MMP1533 MMP1635 MMP1641 Mma-sR05 Mma-sR07 RNA_3 | tfx + pyrD trpE exoA thyA gapN pheA tRNA-Ala2 | 50S ribosomal protein L31e | tungsten containing formylmethanofruran dehydrogenase subunit C-related protein | putative transcriptional regulator | ferredoxin | Na(+)/H(+) exchanger family protein | pyridoxal biosynthesis lyase PdxS | hypothetical protein | glyceraldehyde-3-phosphate dehydrogenase | putative oxidoreductase | dihydroorotate dehydrogenase 1B | binding-protein dependent transport system inner membrane protein | 2-hydroxyglutaryl-CoA dehydratase subunit A-like protein | TPR repeat-containing protein | anthranilate synthase component I | exodeoxyribonuclease III Xth | thymidylate synthase | aldehyde dehydrogenase | modulator of DNA gyrase | prephenate dehydratase | redox-active disulfide protein 1 | soluble P-type ATPase | tRNA-Ala |
| 97 | 25 | 56 | -0.694 | | 
Residual = 0.648 |  | 
cGGGGGCT | 
GcTcAGaGGG |  | MMP0023 MMP0034 MMP0061 MMP0072 MMP0266 MMP0284 MMP0319 MMP0530 MMP0588 MMP0688 MMP0706 MMP0891 MMP1026 MMP1150 MMP1200 MMP1205 MMP1265 MMP1361 MMP1494 MMP1498 MMP1501 MMP1577 MMP1595 MMP1631 MMP1662 | aIF6 infB cbiL dph5 argS mtaA lysA aroA Gln rpoB2 hat cbiF | hypothetical protein | GTP cyclohydrolase | translation initiation factor IF-6 | MarC family integral membrane protein | translation initiation factor IF-2 | precorrin-2 C-20 methyltransferase | diphthine synthase | O-phosphoseryl-tRNA synthetase | NAD binding site:UDP-glucose/GDP-mannose dehydrogenase | exonuclease | arginyl-tRNA synthetase | uroporphyrinogen decarboxylase | diaminopimelate decarboxylase | 3-phosphoshikimate 1-carboxyvinyltransferase | glutamyl-tRNA(Gln) amidotransferase subunit E | DNA-directed RNA polymerase subunit beta'' | phosphodiesterase | histone acetyltransferase, ELP3 family | queuine/other tRNA-ribosyltransferase: | PA-phosphatase related phosphoesterase | precorrin-4 C11-methyltransferase |
| 98 | 28 | 57 | 1.168 | | 
Residual = 0.661 |  | 
TaTctGGgGGGatA | 
TAACCAtAATGcttcCTGgaG |  | MMP0004 MMP0019 MMP0051 MMP0101 MMP0167 MMP0172 MMP0215 MMP0259 MMP0292 MMP0463.2 MMP0646 MMP0771 MMP1311 MMP1390 MMP1413 MMP1435 MMP1523 MMP1576 MMP1602 MMP1652 MMP1688 MMP1706 MMP1708 MMP1721 Mma-sR08 RNA_14 RNA_35 RNA_43 | hisE rplP0 rps14P secE secD rps27e tRNA-Arg2 tRNA-Thr2 tRNA-Trp | hypothetical protein | phosphoribosyl-ATP pyrophosphatase | ABC transporter ATP-binding protein | acidic ribosomal protein P0 | ferredoxin | 30S ribosomal protein S14P | preprotein translocase subunit SecE | preprotein translocase subunit SecD | molybdate ABC transporter periplasmic substrate-binding protein | H/ACA RNA-protein complex component Nop10p | 30S ribosomal protein S27e | tRNA-Arg | tRNA-Thr | tRNA-Trp |
| 99 | 27 | 56 | 0.316 | | 
Residual = 0.711 |  | 
CgggttcncgcCCgTnGCtgaGcC | 
tTatTTngcGgttTAAatgtnAA |  | MMP0009 MMP0505 MMP0530 MMP0566 MMP0664 MMP0715 MMP0730 MMP0754 MMP0808 MMP0814 MMP0834 MMP0876 MMP0899 MMP1164 MMP1172 MMP1184 MMP1214 MMP1393 RNA_12 RNA_18 RNA_2 RNA_20 RNA_21 RNA_23 RNA_30 RNA_41 RNA_9 | mtbA cofG tRNA-Val1 tRNA-Ile1 tRNA-Ala2 tRNA-Phe1 tRNA-Asn1 tRNA-Glu2 tRNA-Gly2 rrnB16S | putative DNA primase large subunit | hypothetical protein | AMP-binding domain protein | coenzyme F390 synthetase II | uroporphyrinogen decarboxylase | FO synthase subunit 1 | ATP/GTP-binding motif-containing protein | heavy metal transport/detoxification protein | DNA protection protein DPS | N-acetyltransferase related protein | tRNA-Val | tRNA-Ile | tRNA-Ala | tRNA-Phe | tRNA-Asn | tRNA-Glu | tRNA-Gly | 16S ribosomal RNA |
| 100 | 23 | 58 | -1.272 | | 
Residual = 0.809 |  | 
gTATCAATAAtTgCGaGAgG | 
CGGTtTgcacccGTaCcCcTTCCC |  | MMP0195 MMP0268 MMP0326 MMP0459 MMP0462 MMP0466 MMP0467 MMP0469 MMP0470 MMP0471 MMP0472 MMP0493 MMP0510 MMP0513 MMP0741 MMP0743 MMP0744 MMP0747 MMP0748 MMP0777 MMP1051 MMP1321 MMP1481 | truA metG cobN fmdC MoeA surE rps11p cbiM | hypothetical protein | tRNA pseudouridine synthase A | methionyl-tRNA synthetase | MCE family-like protein | integrase/recombinase | cobaltochelatase subunit CobN | molybdenum containing formylmethanofuran dehydrogenase subunit C | molybdopterin biosynthesis moeA protein | stationary phase survival protein SurE | 30S ribosomal protein S11P | cobalt transport protein CbiM |
| 101 | 18 | 56 | -2.282 | | 
Residual = 0.506 |  | 
TATATATAaTTTtCTATTTaa | 
TCaGGcGA |  | MMP0041 MMP0056 MMP0585 MMP0656 MMP0682 MMP0701 MMP0712 MMP0783 MMP0855 MMP1135 MMP1224 MMP1248 MMP1258 MMP1439 MMP1493 MMP1555 MMP1558 MMP1559 | tfb cofH nifI2 fwdA hemB mcrB mcrG mcrA | transcription initiation factor IIB | FO synthase subunit 2 | UspA domain-containing protein | hypothetical protein | amino acid ABC transporter substrate-binding protein | nitrogen regulatory protein P-II | flavodoxin:Beta-lactamase-like | ABC-type amino acid transport/signal transduction systems periplasmic component-related | tungsten containing formylmethanofuran dehydrogenase, subunit A | delta-aminolevulinic acid dehydratase | cofactor-independent phosphoglycerate mutase | methyl-coenzyme M reductase I, beta subunit | methyl-coenzyme M reductase I, gamma subunit | methyl-coenzyme M reductase I, alpha subunit |
| 102 | 18 | 55 | -2.421 | | 
Residual = 0.551 |  | 
TagattAATtaaTAAATAgtT | 
AGaGGTGA |  | MMP0025 MMP0152 MMP0229 MMP0253 MMP0289 MMP0309 MMP0350 MMP0396 MMP0594 MMP1128 MMP1210 MMP1211 MMP1212 MMP1213 MMP1344 MMP1535 MMP1537 MMP1585 | acd hypD eno ppiB | hypothetical protein | citrate transporter | amino acid ABC transporter ATP-binding protein | CoA-binding domain protein | hydrogenase expression/formation protein HypD | DsrE family protein | hexapeptide repeat-containing transferase | enolase | peptidyl-prolyl cis-trans isomerase, cyclophilin type | acetyl-CoA acetyltransferase | cytochrome c heme-binding site | arginase |
| 103 | 18 | 56 | -0.813 | | 
Residual = 0.518 |  | 
ttgtTtTATctGgtt | 
GaGCGC |  | MMP0004 MMP0155 MMP0158 MMP0262 MMP0310 MMP0640 MMP0880 MMP1071 MMP1104 MMP1116 MMP1198 MMP1398 MMP1404 MMP1405 MMP1407 MMP1424 MMP1440 MMP1496 | rps28e aksF pyrI dapE rps3p rpmC pheS | hypothetical protein | 30S ribosomal protein S28e | isopropylmalate/isohomocitrate dehydrogenase | aspartate carbamoyltransferase regulatory subunit | cellulase | nitrate/sulfonate/bicarbonate ABC transporter ATPase | diaminopimelate aminotransferase | 30S ribosomal protein S3P | 50S ribosomal protein L29 | ribonuclease P protein component 1 | oligosaccharyl transferase, STT3 subunit | tRNA-modifying enzyme | phenylalanyl-tRNA synthetase subunit alpha |
| 104 | 17 | 57 | -1.669 | | 
Residual = 0.495 |  | 
GGTGATTT | 
GCgtTtGTaGaaGgACt |  | MMP0212 MMP0264 MMP0336 MMP0584 MMP0650 MMP0651 MMP0879 MMP0893 MMP0894 MMP0900 MMP0936 MMP0939 MMP1217 MMP1431 MMP1510 MMP1516 MMP1594 | MscMJ hjc valS ilvB ilvH serS pyrG guaA aroE subfamily IA 2pgk gatA | glycyl-tRNA synthetase | MscS mechanosensitive ion channel | Holliday junction resolvase | valyl-tRNA synthetase | acetolactate synthase catalytic subunit | acetolactate synthase 3 regulatory subunit | seryl-tRNA synthetase | CTP synthetase | GMP synthase subunit B | rhodanese domain protein | shikimate 5-dehydrogenase | HAD superfamily (subfamily IA) hydrolase | hypothetical protein | 2-phosphoglycerate kinase | aspartyl/glutamyl-tRNA amidotransferase subunit A |
| 105 | 26 | 57 | -1.338 | | 
Residual = 0.852 |  | 
CCcCCaAA | 
TATATAtaaTTaTCatTattAta |  | MMP0036 MMP0110 MMP0114 MMP0116 MMP0247 MMP0509 MMP0528 MMP0613 MMP0662 MMP0731 MMP0846 MMP0914 MMP0992 MMP0993 MMP1073 MMP1134 MMP1374 MMP1413 MMP1461 MMP1468 MMP1470 MMP1482 MMP1587 MMP1706 Mma-sR03 RNA_45 | tfe argC fmdA ehbC rnhB rps14P ehaN pdfA | transcription initiation factor E subunit alpha | ABC transporter:AAA ATPase | xylose isomerase domain protein TIM barrel | N-acetyl-gamma-glutamyl-phosphate reductase | ribosomal biogenesis protein | formylmethanofuran dehydrogenase, subunit A | hypothetical protein | acetolactate decarboxylase | exodeoxyribonuclease VII small subunit | XRE family transcriptional regulator | putative monovalent cation/H+ antiporter subunit G | type A flavoprotein | ribonuclease HII | 30S ribosomal protein S14P | energy conserving hydrogenase A small subunit | prefoldin subunit alpha | cobalt transport protein CbiN | H/ACA RNA-protein complex component Nop10p |
| 106 | 29 | 57 | -1.698 | | 
Residual = 0.890 |  | 
aCaAAttttATTtAtAatTTTaaA | 
CccgAtCaCCGCCG |  | MMP0047 MMP0090 MMP0124 MMP0170 MMP0205 MMP0217 MMP0307 MMP0320 MMP0342 MMP0374 MMP0388 MMP0404 MMP0409 MMP0473 MMP0474 MMP0495 MMP0507 MMP0663 MMP0806 MMP0874 MMP0967 MMP1056 MMP1226 MMP1269 MMP1274 MMP1337 MMP1476 MMP1597 MMP1664 | cofF modA cofD | radical SAM domain protein | glycosyl transferase | membrane-bound metal-dependent hydrolase | alpha-L-glutamate ligase, RimK family | molybdenum ABC transporter, periplasmic molybdenum-binding protein | transcriptional repressor related protein | hypothetical protein | shikimate kinase | geranylgeranyl reductase | LPPG:FO 2-phospho-L-lactate transferase | glucose-methanol-choline oxidoreductase | molybdenum ABC transporter periplasmic molybdate-binding protein | sulphate transporter | SAM-binding motif-containing protein | AMP-dependent synthetase and ligase | hydrogenase maturation protease, related | phosphatidylglycerophosphatase A |
| 107 | 27 | 58 | -0.652 | | 
Residual = 0.759 |  | 
tTtaacCAGaTAtTcTcttTaTAA | 
TGGTGG |  | MMP0100 MMP0269 MMP0318 MMP0332 MMP0351 MMP0356 MMP0363 MMP0402 MMP0404 MMP0545 MMP0579 MMP0636 MMP0804 MMP0835 MMP0917 MMP1343 MMP1345 MMP1346 MMP1347 MMP1348 MMP1349 MMP1350 MMP1353 MMP1354 MMP1356 MMP1534 MMP1601 | + ilvD aspB-like1 cofD dapF di-trans-poly-cis-decaprenylcistransferase HMmB | Na(+)/H(+) exchanger family protein | hypothetical protein | dihydroxy-acid dehydratase | DegT/DnrJ/EryC1/StrS aminotransferase | glycosyl transferase, group 1 | methanol dehydrogenase regulatory protein related protein | LPPG:FO 2-phospho-L-lactate transferase | molybdenum cofactor biosynthesis protein MoeA | diaminopimelate epimerase | undecaprenyl pyrophospahte synthetase related protein (di-trans-poly-cis-decaprenylcistransferase) | basic helix-loop-helix dimerization domain-containing protein | histone B | NAD+ synthase related protein | radical SAM domain protein | thiamine biosynthesis protein | PP-loop domain protein | putative RNA methylase |
| 108 | 28 | 58 | -0.250 | | 
Residual = 0.663 |  | 
CGGTGA | 
GCCGGA |  | MMP0030 MMP0169 MMP0254 MMP0326 MMP0337 MMP0411 MMP0527 MMP0536 MMP0650 MMP0809 MMP0874 MMP0958 MMP0979 MMP0982 MMP0984 MMP1056 MMP1060 MMP1072 MMP1109 MMP1281 MMP1295 MMP1296 MMP1297 MMP1298 MMP1334 MMP1489 MMP1503 MMP1511 | metG comD ilvB cdh cysS subgroup I pfkC fdhB fdhA pnk porE | MCM family DNA replication protein | peptidase M50 | carbohydrate kinase, YjeF related protein | methionyl-tRNA synthetase | hypothetical protein | sulfopyruvate decarboxylase subunit alpha | acetolactate synthase catalytic subunit | phosphoribosylaminoimidazole carboxylase related protein | SAM-binding motif-containing protein | acetyl-CoA decarbonylase/synthase complex subunit epsilon | cysteinyl-tRNA synthetase | aminotransferase (subgroup I) aromatic aminotransferase | GCN5-related N-acetyltransferase | glucose-6-phosphate isomerase | ADP-specific phosphofructokinase | formate dehydrogenase beta subunit | formate dehydrogenase alpha subunit | solute-binding protein/glutamate receptor | inorganic polyphosphate/ATP-NAD kinase | pyruvate oxidoreductase-associated | amino acid carrier protein |
| 109 | 26 | 57 | -1.205 | | 
Residual = 0.807 |  | 
TtCACCcGagataTTCTggngGAA | 
AAttCACatTTGaGG |  | MMP0002 MMP0071 MMP0091 MMP0282 MMP0340 MMP0383 MMP0384 MMP0498 MMP0574 MMP0846 MMP0879 MMP0915 MMP0920 MMP0944 MMP0998 MMP1081 MMP1092 MMP1180 MMP1189 MMP1241 MMP1539 MMP1562 MMP1583 MMP1617 MMP1619 Mma-sR01 | purE pycB slp serS cobY/cofC ahcY wbpG mtrC | L-seryl-tRNA selenium transferase | DNA primase, small subunit | hypothetical protein | phosphoribosylaminoimidazole carboxylase, catalytic subunit | pyruvate carboxylase subunit B | S-layer protein | seryl-tRNA synthetase | nucleoside triphosphate: 5'-deoxyadenosylcobinamide phosphate nucleotidyltransferase | S-adenosyl-L-homocysteine hydrolase | putative LPS biosynthesis protein WbpG | auxin efflux carrier | ribose-5-phosphate isomerase A | tetrahydromethanopterin S-methyltransferase subunit C | S-adenosylmethionine decarboxylase related | molybdenum cofactor biosynthesis protein MoeA |
| 110 | 33 | 57 | 1.283 | | 
Residual = 0.689 |  | 
TATcaCCTcnaAaA | 
GgtAGtagtAGngGAacCtGCgGc |  | MMP0050 MMP0246 MMP0461 MMP0503 MMP0569 MMP0575 MMP0577 MMP0639 MMP0654 MMP0662 MMP0671 MMP0724 MMP0736 MMP0779 MMP0786 MMP0912 MMP0962 MMP0972 MMP1141 MMP1167 MMP1182 MMP1329 MMP1406 MMP1459 MMP1600 MMP1661 RNA_15 RNA_20 RNA_28 RNA_36 RNA_42 RNA_45 RNA_49 | ribH gatC rps17E ilvC ywbE ehaL glutaminyl transferase tRNA-Arg3 tRNA-Phe1 tRNA-Cys1 tRNA-Ala2 rrnC23S | 6,7-dimethyl-8-ribityllumazine synthase | hypothetical protein | aspartyl/glutamyl-tRNA amidotransferase subunit C | 30S ribosomal protein S17e | 50S ribosomal protein L23E | ketol-acid reductoisomerase | PRC-barrel domain protein | 4-oxalocrotonate tautomerase | zinc finger protein | ATP-dependent helicase | flavoprotein related protein | transport system permease protein | ferredoxin | translation initiation factor Sui1 | ribosomal protein S6 modification enzyme (glutaminyl transferase) related | tRNA-Arg | tRNA-Phe | tRNA-Cys | tRNA-Ala | 23S ribosomal RNA |
| 111 | 31 | 56 | 0.411 | | 
Residual = 0.713 |  | 
gCTAgAACTAATGGTgCGAGAGG | 
CaCcCagCTatTAtatGgcATaTC |  | MMP0127 MMP0142 MMP0385 MMP0411 MMP0483 MMP0649 MMP0679 MMP0948 MMP0960 MMP0965 MMP1017 MMP1018 MMP1087 MMP1088 MMP1109 MMP1140 MMP1244 MMP1299 MMP1300 MMP1389 MMP1472 MMP1517 MMP1572 MMP1611 MMP1655 MMP1714 RNA_17 RNA_2 RNA_22 RNA_31 RNA_46 | hmd pyrH comD lysC cimA fdxA fwdH tRNA-Pro2 tRNA-Ala2 tRNA-Met2 tRNA-Ala1 rrnA5S | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase | thiamine pyrophosphate dependent enzyme related to acetolactate synthase | uridylate kinase | sulfopyruvate decarboxylase subunit alpha | hypothetical protein | carbamoyltransferase | Na+/H+ antiporter related protein | formylmethanofuran dehydrogenase subunit E related protein | aspartate kinase | (R)-citramalate synthase | glycosyl transferase, group 1 | ferredoxin | tungsten containing formylmethanofuran dehydrogenase, subunit H | carbonic anhydrase | peptidase M50 | roadblock/LC7 family protein | tRNA-Pro | tRNA-Ala | tRNA-Met | 5S ribosomal RNA |
| 112 | 27 | 58 | 0.087 | | 
Residual = 0.691 |  | 
TCgaaCATATGGg | 
GAgtGGgacG |  | MMP0009 MMP0068 MMP0274 MMP0332 MMP0449 MMP0455 MMP0460 MMP0464 MMP0481 MMP0520 MMP0568 MMP0767 MMP0768 MMP0769 MMP0773 MMP0775 MMP0789 MMP0806 MMP0807 MMP0824 MMP0832 MMP0974 MMP1069 MMP1143 MMP1350 MMP1430 MMP1520 | amtB hypE transporting codB vhcB | putative DNA primase large subunit | ammonium transporter | hydrogenase expression/formation protein HypE | hypothetical protein | ferredoxin | amino-acid ABC transporter | ATPase, P-type (transporting), HAD superfamily, subfamily IC | transcriptional regulator related protein | cytosine permease | carboxymuconolactone decarboxylase related protein | coenzyme F420-non-reducing hydrogenase subunit beta | basic helix-loop-helix dimerization domain-containing protein | TPR repeat-containing protein | radical SAM domain protein | cation transporter | hydrogenase accessory protein HypB |
| 113 | 14 | 57 | -3.008 | | 
Residual = 0.595 |  | 
cGAGGTaA | 
cGGAGCA |  | MMP0056 MMP0230 MMP0490 MMP0953 MMP1039 MMP1040 MMP1041 MMP1042 MMP1046 MMP1047 MMP1305 MMP1560 MMP1561 MMP1567 | cofH cbiH atpI atpK atpE atpC atpD mtrE mtrD mtrH | FO synthase subunit 2 | metal dependent phosphohydrolase | hypothetical protein | precorrin-3B C17-methyltransferase | V-type ATP synthase subunit I | V-type ATP synthase subunit K | A1A0 ATPase, subunit IE | V-type ATP synthase subunit C | V-type ATP synthase subunit D | tetrahydromethanopterin S-methyltransferase subunit E | tetrahydromethanopterin S-methyltransferase subunit D | tetrahydromethanopterin S-methyltransferase subunit H |
| 114 | 24 | 57 | -0.745 | | 
Residual = 0.606 |  | 
GaGGgGA | 
GTcGGCG |  | MMP0194 MMP0232 MMP0294 MMP0475 MMP0497 MMP0533 MMP0549 MMP0634 MMP0656 MMP0675 MMP0702 MMP0718 MMP0762 MMP0766 MMP0825 MMP0852 MMP0854 MMP0964 MMP0996 MMP1174 MMP1175 MMP1292 MMP1293 MMP1475 | resP hdrA NifI1 | hypothetical protein | Pyrrolo-quinoline quinone | TPR repeat-containing protein | site-specific recombinase | heterodisulfide reductase subunit A | nitrogen regulatory protein P-II | peroxiredoxin | glycoside hydrolase 15-related | glycosyl transferase, group 1 |
| 115 | 26 | 58 | -1.376 | | 
Residual = 0.764 |  | 
GGTGAt | 
AaAtTtAAtGATTTagATatttT |  | MMP0297 MMP0606 MMP0643 MMP0665 MMP0678 MMP0707 MMP0708 MMP0999 MMP1033 MMP1034 MMP1035 MMP1036 MMP1070 MMP1129 MMP1145 MMP1168 MMP1204 MMP1231 MMP1240 MMP1494 MMP1515 MMP1550 MMP1596 MMP1605 MMP1627 MMP1662 | aIF-2_beta tmk ppiB minD hsp60 ehbG cbiF | translation initiation factor IF-2 subunit beta | ribosomal RNA methyltransferase RrmJ/FtsJ | hypothetical protein | sodium/hydrogen exchanger | thymidylate kinase | Band 7 protein:stomatin | peptidyl-prolyl cis-trans isomerase, cyclophilin type | septum formation inhibitor-activating ATPase | ABC transporter ATP-binding protein | M24 family metallopeptidase | HAD family hydrolase fragment | Sep-tRNA:Cys-tRNA synthetase | chaperonin GroEL | NADP oxidoreductase, coenzyme F420-dependent | pyruvate kinase | precorrin-4 C11-methyltransferase |
| 116 | 22 | 58 | -2.079 | | 
Residual = 0.682 |  | 
GTGTATTTGTGACACATCCGCTG | 
GGACATTCCACGCTAGTTC |  | MMP0278 MMP0296 MMP0457 MMP0515 MMP0699 MMP0727 MMP0728 MMP0905 MMP0906 MMP0907 MMP0908 MMP1019 MMP1033 MMP1034 MMP1051 MMP1061 MMP1065 MMP1173 MMP1239 MMP1284 MMP1514 MMP1634 | modB uvrB uvrC tmk surE tyrA | putative signal transduction protein with CBS domains | hypothetical protein | DEAD/DEAH box helicase domain protein | molybdenum ABC transporter permease | MATE efflux family protein | excinuclease ABC subunit B | excinuclease ABC subunit C | ribonuclease Z | transcriptional regulator TrmB | CBS domain-containing protein | PEGA domain protein | thymidylate kinase | stationary phase survival protein SurE | BadM/Rrf2 family transcriptional regulator | zinc/iron permease | prephenate dehydrogenase | DsrE family protein |
| 117 | 28 | 55 | -0.495 | | 
Residual = 0.798 |  | 
TgACCCagCTCaatGAcgCC | 
CCtgCcccTGcA |  | MMP0003 MMP0011 MMP0040 MMP0131 MMP0188 MMP0229 MMP0305 MMP0339 MMP0577 MMP0738 MMP0753 MMP0801 MMP0833 MMP0873 MMP0940 MMP0973 MMP1036 MMP1038 MMP1052 MMP1383 MMP1466 MMP1501 MMP1575 MMP1596 MMP1629 RNA_1 RNA_25 RNA_32 | korA rps17E atpH fruD ehaS bioW ehbE tRNA-Ala2 tRNA-His1 tRNA-Ser3 | 2-oxoglutarate ferredoxin oxidoreductase subunit alpha | DNA-cytosine methyltransferase | type II secretion system protein E | L-tyrosine decarboxylase | diphthamide biosynthesis protein | amino acid ABC transporter ATP-binding protein | 2-oxoacid ferredoxin oxidoreductase subunit beta | NUDIX hydrolase | 30S ribosomal protein S17e | elongation factor Tu domain-containing protein | hypothetical protein | TPR repeat-containing protein | Band 7 protein:stomatin | A1A0 ATPase, subunit H | coenzyme F420-reducing hydrogenase delta subunit | putative signal transduction protein with CBS domains | phosphodiesterase | 6-carboxyhexanoate--CoA ligase | putative monovalent cation/H+ antiporter subunit C | tRNA-Ala | tRNA-His | tRNA-Ser |
| 118 | 15 | 56 | -3.332 | | 
Residual = 0.560 |  | 
GGAGGt | 
CCTGaaAAGGCGcaaGcC |  | MMP0082 MMP0083 MMP0249 MMP0596 MMP0971 MMP1322 MMP1365 MMP1405 MMP1409 MMP1410 MMP1412 MMP1414 MMP1416 MMP1419 MMP1543 | rpl37ae NOP5/NOP56 purB rpoD rpmC rpl14p rpl24p rpl5p rps8p rpl32e rps5p rpl3p | glutamate synthase; large subunit; subunit 3 | coenzyme F420 hydrogenase/dehydrogenase beta subunit domain protein | 50S ribosomal protein L37Ae | RNA 2'-O-methyl modification protein (NOP5/NOP56) | adenylosuccinate lyase | DNA-directed RNA polymerase, subunit D | 50S ribosomal protein L30e | 50S ribosomal protein L29 | 50S ribosomal protein L14P | 50S ribosomal protein L24P | 50S ribosomal protein L5P | 30S ribosomal protein S8P | 50S ribosomal protein L32e | 30S ribosomal protein S5P | 50S ribosomal protein L3P |
| 119 | 13 | 57 | -0.832 | | 
Residual = 0.508 |  | 
GGcGcTgG | 
GaGGTGC |  | MMP0063 MMP0154 MMP0157 MMP0397 MMP0399 MMP0401 MMP1362 MMP1419 MMP1473 MMP1497 MMP1509 MMP1579 MMP1658 | argB alaS htpX metE rpoB1 rps5p rps15p | acetylglutamate kinase | hypothetical protein | alanyl-tRNA synthetase | heat shock protein HtpX | methionine synthase | DNA-directed RNA polymerase subunit B' | 30S ribosomal protein S5P | 30S ribosomal protein S15P | 30S ribosomal protein S8e |
| 120 | 20 | 59 | -0.406 | | 
Residual = 0.795 |  | 
GgGCTtagCaAGGGGGc | 
CcGgTGttaCACCtC |  | MMP0002 MMP0091 MMP0133 MMP0292 MMP0343 MMP0562 MMP0663 MMP0675 MMP0790 MMP0819 MMP1023 MMP1137 MMP1167 MMP1188 MMP1612 MMP1649 MMP1651 MMP1652 Mma-sR02 RNA_6 | guaB frcD modC modA tRNA-Ala2 | L-seryl-tRNA selenium transferase | hypothetical protein | inosine-5'-monophosphate dehydrogenase | sulphate transporter | coenzyme F420-reducing hydrogenase subunit delta | TetR family transcriptional regulator | Lrp/AsnC family transcriptional regulator | flavoprotein related protein | ABC transporter ATPase | molybdenum ABC transporter periplasmic molybdate-binding protein | molybdate ABC transporter periplasmic substrate-binding protein | tRNA-Ala |
| 121 | 21 | 56 | -0.496 | | 
Residual = 0.591 |  | 
ACGGGC | 
ttAAAgAAtTgGagG |  | MMP0013 MMP0044 MMP0157 MMP0416 MMP0427 MMP0527 MMP0536 MMP0610 MMP0626 MMP0668 MMP0669 MMP0677 MMP0732 MMP1197 MMP1227 MMP1363 MMP1443 MMP1474 MMP1570 MMP1573 MMP1574 | argH rfc tgtA cmk xseA cbiE rpoA1 ileS bioD bioF | argininosuccinate lyase | beta-lactamase domain protein | hypothetical protein | replication factor C small subunit | 7-cyano-7-deazaguanine tRNA-ribosyltransferase | cytidylate kinase | 30S ribosomal protein S3Ae | exodeoxyribonuclease VII large subunit | binding-protein-dependent transport systems inner membrane component | cobalt-precorrin-6Y C(5)-methyltransferase | DNA-directed RNA polymerase subunit A' | ATP/GTP-binding motif-containing protein | isoleucyl-tRNA synthetase | hydrolase, TatD family | dethiobiotin synthase | 8-amino-7-oxononanoate synthase |
| 122 | 24 | 56 | -1.228 | | 
Residual = 0.793 |  | 
TGAaAaaGcGc | 
CCaCGGGC |  | MMP0012 MMP0075 MMP0231 MMP0637 MMP0672 MMP0673 MMP0682 MMP0683 MMP0842 MMP0898 MMP0922 MMP1098 MMP1100 MMP1166 MMP1206 MMP1278 MMP1279 MMP1294 MMP1454 MMP1519 MMP1542 MMP1590 MMP1647 MMP1674 | ftsY pstB glnA glgA ehaG psmR flaH | CoA-binding domain protein | abortive infection protein | cysteine-rich small domain | ArsR family transcriptional regulator | binding-protein dependent transport system inner membrane protein | TPR repeat-containing protein | hypothetical protein | signal recognition particle-docking protein FtsY | cellulose-binding | putative phage infection protein | phosphate ABC transporter ATPase | putative transcriptional regulator | iron-sulfur flavoprotein | glutamine synthetase | camphor resistance CrcB protein | starch synthase | anion transport system permease protein | translin family protein | ExsB family protein | proteasome-activating nucleotidase | flagellar accessory protein FlaH |
| 123 | 25 | 56 | -1.118 | | 
Residual = 0.796 |  | 
TTTTAAtTAGTTaTtAaaaTgtt | 
AGCGGtgggAg |  | MMP0016 MMP0033 MMP0119 MMP0181 MMP0197 MMP0300 MMP0553 MMP0555 MMP0560 MMP0581 MMP0634 MMP0881 MMP0938 MMP0944 MMP0970 MMP1010 MMP1065 MMP1131 MMP1145 MMP1205 MMP1360 MMP1361 MMP1548 MMP1549 MMP1550 | birA III argF flaK cobS lig minD aroA rpoH rpoB2 | hypothetical protein | LysR family protein | biotin--acetyl-CoA-carboxylase ligase | ABC-type iron(III) transport system, permease component | ornithine carbamoyltransferase | preflagellin peptidase | SAM-binding motif-containing protein | cobalamin (5'-phosphate) synthase | DNA ligase I, ATP-dependent Dnl1 | pseudouridine synthase, RluA family | BadM/Rrf2 family transcriptional regulator | peptide chain release factor 1 | septum formation inhibitor-activating ATPase | 3-phosphoshikimate 1-carboxyvinyltransferase | DNA-directed RNA polymerase subunit H | DNA-directed RNA polymerase subunit beta'' | Fe-S type hydro-lyase tartrate/fumarate beta region | AP endonuclease | NADP oxidoreductase, coenzyme F420-dependent |
| 124 | 25 | 56 | -0.505 | | 
Residual = 0.801 |  | 
GtGcGacaGTCGGG | 
ACAATTTTTAcgGg |  | MMP0018 MMP0023 MMP0039 MMP0095 MMP0197 MMP0220 MMP0329 MMP0436 MMP0442 MMP0525 MMP0549 MMP0590 MMP0713 MMP0827 MMP0855 MMP0932 MMP1052 MMP1080 MMP1229 MMP1252 MMP1262 MMP1280 MMP1285 MMP1598 MMP1642 | III rimK iorA2 nifI2 | LysR family transcriptional regulator | hypothetical protein | ABC-type iron(III) transport system, permease component | Sodium/proline symporter-related | RimK domain protein ATP-grasp | glycosyl transferase family protein | indolepyruvate oxidoreductase subunit alpha 2 | nitrogen regulatory protein P-II | CheC, inhibitor of MCP methylation | glycosyl transferase, group 1 | FUN14 family protein | CBS domain-containing protein | ATP/GTP-binding motif-containing protein |
| 125 | 25 | 57 | 1.490 | | 
Residual = 0.737 |  | 
GGgTCAGg | 
GcGAgGGAC |  | MMP0048 MMP0059 MMP0186 MMP0243 MMP0269 MMP0327 MMP0463.2 MMP0472 MMP0484 MMP0485 MMP0540 MMP0812 MMP0822 MMP0828 MMP0865 MMP0966 MMP1028 MMP1088 MMP1186 MMP1232 MMP1470 MMP1603 MMP1643 MMP1646 MMP1655 | deoA purC vhcG subgroup II cobA lon pdfA | hypothetical protein | thymidine phosphorylase | integrase/recombinase | sodium/hydrogen exchanger | phosphoribosylaminoimidazole-succinocarboxamide synthase | coenzyme F420-non-reducing hydrogenase subunit gamma | aminotransferase (subgroup II) adenosylmethionine-8-amino-7-oxononanoate aminotransferase | uroporphyrin-III C-methyltransferase | glycosyl transferase, group 1 | thiol (cysteine) protease | PP-loop domain protein | prefoldin subunit alpha | ferredoxin |
| 126 | 23 | 56 | -1.019 | | 
Residual = 0.542 |  | 
GGgAggTGgCT | 
GGGCGc |  | MMP0035 MMP0058 MMP0064 MMP0066 MMP0102 MMP0270 MMP0689 MMP0720 MMP1027 MMP1089 MMP1095 MMP1096 MMP1097 MMP1098 MMP1206 MMP1302 MMP1304 MMP1388 MMP1442 MMP1447 MMP1541 MMP1613 MMP1697 | mer glnK1 glnB pcm pstB glnA ssh10b_1 hdrA | hypothetical protein | methylenetetrahydromethanopterin reductase | nitrogen regulatory protein P-II | protein-L-isoaspartate O-methyltransferase | Fe-S cluster domain protein | xanthine/uracil permease family protein | hydroxylamine reductase | polysaccharide biosynthesis protein | phosphate-binding protein | phosphate ABC transporter inner membrane protein | phosphate ABC transporter ATPase | glutamine synthetase | response regulator receiver protein | redox-active disulfide protein 2 | transcription regulator ArsR | Cro repressor family protein | DNA/RNA-binding protein albA | heterodisulfide reductase, subunit A |
| 127 | 22 | 56 | -0.361 | | 
Residual = 0.710 |  | 
GGGGcAC | 
cCAaAAcC |  | MMP0152 MMP0209 MMP0364 MMP0447 MMP0458 MMP0463 MMP0734 MMP0739 MMP0887 MMP0940 MMP1048 MMP1287 MMP1303 MMP1438 MMP1439 MMP1484 MMP1492 MMP1549 MMP1632 MMP1645 MMP1660 MMP1663 | cbiO pyrE yqiX | citrate transporter | hypothetical protein | nitrogenase related protein | Asp/Glu racemase:aspartate racemase | stress responsive alpha-beta barrel domain protein | sensory transduction histidine kinase | cofactor-independent phosphoglycerate mutase | cobalt transporter ATP-binding subunit | orotate phosphoribosyltransferase | AP endonuclease | glutamate-binding protein | aspartate/glutamate/uridylate kinase |
| 128 | 24 | 58 | 0.350 | | 
Residual = 0.733 |  | 
TtAAAAGGtGG | 
tGGtgAAA |  | MMP0057 MMP0088 MMP0139 MMP0164 MMP0177 MMP0202 MMP0287 MMP0288 MMP0291 MMP0333 MMP0352 MMP0395 MMP0559 MMP0580 MMP0704 MMP0919 MMP1018 MMP1081 MMP1118 MMP1287 MMP1467 MMP1591 MMP1654 MMP1718 | cofH hemA fdhB cbiX(s) act cimA wbpG ehaT cbiG | FO synthase subunit 2 | glutamyl-tRNA reductase | formate dehydrogenase beta subunit | sirohydrochlorin cobaltochelatase | hypothetical protein | permease | CBS domain containing protein | hydrogenase expression/formation protein related | putative oxidoreductase | anaerobic ribonucleoside-triphosphate reductase activating protein | ParA type ATPase | dihydroorotate dehydrogenase electron transfer subunit | (R)-citramalate synthase | putative LPS biosynthesis protein WbpG | cobalamin (vitamin B12) biosynthesis CbiG protein |
| 129 | 27 | 56 | -0.787 | | 
Residual = 0.662 |  | 
tTTTAAAAtATnTT | 
CAGGcAtGCTTGCaGgTg |  | MMP0045 MMP0106 MMP0155 MMP0228 MMP0308 MMP0316 MMP0323 MMP0397 MMP0418 MMP0438 MMP0443 MMP0454 MMP0607 MMP0611 MMP0648 MMP0747 MMP0836 MMP0882 MMP1013 MMP1061 MMP1121 MMP1133 MMP1216 MMP1369 MMP1480 MMP1523 MMP1593 | idsA trm1 iorA1 alaS rps24e nrpR rtcA purM carB comC hisC aEF-2 secD | bifunctional short chain isoprenyl diphosphate synthase | hypothetical protein | N(2),N(2)-dimethylguanosine tRNA methyltransferase | SirA family protein | indolepyruvate oxidoreductase subunit alpha 1 | alanyl-tRNA synthetase | carbohydrate kinase, PfkB | 30S ribosomal protein S24e | Beta-lactamase-like | RNA 3'-terminal-phosphate cyclase | 2-hydroxyglutaryl-CoA dehydratase subunit D-like protein | AIR synthase related protein domain protein | carbamoyl-phosphate synthase large chain | metal-dependent phophohydrolase related protein | L-sulfolactate dehydrogenase/(S)-hydroxyglutaric acid dehydrogenase | histidinol-phosphate aminotransferase | elongation factor EF-2 | aconitase family | preprotein translocase subunit SecD |
| 130 | 7 | 56 | -3.631 | | 
Residual = 0.266 |  | 
AGGAGGT | 
TGTCCC |  | MMP1365 MMP1403 MMP1411 MMP1417 MMP1418 MMP1545 MMP1546 | rpl22p rpl19e rpl18p rplW rpl2p | 50S ribosomal protein L30e | 50S ribosomal protein L22P | 30S ribosomal protein S4e | 50S ribosomal protein L19e | 50S ribosomal protein L18P | 50S ribosomal protein L23 | 50S ribosomal protein L2P |
| 131 | 29 | 57 | -0.122 | | 
Residual = 0.863 |  | 
GCTCGcGc | 
CGTTcCCC |  | MMP0027 MMP0169 MMP0267 MMP0288 MMP0290 MMP0341 MMP0570 MMP0771 MMP0788 MMP0818 MMP0823 MMP0886 MMP0958 MMP1000 MMP1043 MMP1062 MMP1064 MMP1067 MMP1072 MMP1137 MMP1196 MMP1218 MMP1237 MMP1238 MMP1392 MMP1456 MMP1487 MMP1606 Mma-sR02 | nac pycA frcG vhcA atpF subgroup I bioB ehaI gapN | TrkA-N domain protein | peptidase M50 | hypothetical protein | nascent polypeptide-associated complex protein | pyruvate carboxylase subunit A | coenzyme F420-reducing hydrogenase subunit gamma | coenzyme F420-non-reducing hydrogenase subunit alpha | cobalt ABC transporter inner membrane protein | V-type ATP synthase subunit F | adenylate cyclase | succinate dehydrogenase/fumarate reductase iron-sulfur subunit | aminotransferase (subgroup I) aromatic aminotransferase | Lrp/AsnC family transcriptional regulator | biotin synthase | aldehyde dehydrogenase | flavoprotein:DNA/pantothenate metabolism flavoprotein |
| 132 | 32 | 57 | -0.701 | | 
Residual = 0.736 |  | 
TagTAAGATaAAAgGTGAAAA | 
anaAAAATATAAaaA |  | MMP0026 MMP0077 MMP0099 MMP0125 MMP0127 MMP0211 MMP0244 MMP0338 MMP0341 MMP0374 MMP0380 MMP0537 MMP0561 MMP0654 MMP0820 MMP0872 MMP0875 MMP1010 MMP1031 MMP1168 MMP1203 MMP1233 MMP1340 MMP1341 MMP1342 MMP1343 MMP1356 MMP1371 MMP1606 MMP1616 MMP1663 MMP1664 | DP2 flpA hmd pycA dnaB nth1 cmd ilvC frcA hemC slpB adkA cbiD mre11 rad50 rps10p aspC | DNA polymerase II large subunit | radical SAM domain protein | major facilitator transporter | fibrillarin-like protein | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase | hypothetical protein | pyruvate carboxylase subunit A | DNA polymerase family B protein | endonuclease III homologue | carboxymuconolactone decarboxylase | ketol-acid reductoisomerase | coenzyme F420-reducing hydrogenase subunit alpha | porphobilinogen deaminase | S layer protein | pseudouridine synthase, RluA family | adenylate kinase | ABC transporter ATP-binding protein | cobalt-precorrin-6A synthase | formate dehydrogenase family accessory protein FdhD | SbcD/Mre11 family DNA repair exonuclease | SMC domain protein | PP-loop domain protein | 30S ribosomal protein S10P | flavoprotein:DNA/pantothenate metabolism flavoprotein | aspartyl-tRNA synthetase |
| 133 | 23 | 56 | -1.615 | | 
Residual = 0.823 |  | 
CTGGGcgg | 
AnTTTTTattTgntTTgnAA |  | MMP0042 MMP0120 MMP0318 MMP0344 MMP0599 MMP0633 MMP0692 MMP0725 MMP0803 MMP0848 MMP1024 MMP1047 MMP1190 MMP1209 MMP1388 MMP1448 MMP1450 MMP1471 MMP1491 MMP1512 MMP1513 MMP1552 MMP1560 | ilvD cbiJ ehaA ehaC trzA alr ald mtrE | H/ACA RNA-protein complex component Gar1 | hypothetical protein | dihydroxy-acid dehydratase | precorrin-6x reductase CbiJ/CobK | rubrerythrin | putative integral membrane protein | peptide methionine sulfoxide reductase | MCE family-like protein | peptidylprolyl isomerase, FKBP-type | redox-active disulfide protein 2 | amidohydrolase | alanine racemase | alanine dehydrogenase | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase | tetrahydromethanopterin S-methyltransferase subunit E |
| 134 | 28 | 54 | 2.392 | | 
Residual = 1.000 |  | 
ggtGCttTgtggGccTAaAa | 
ATCCgGCCcgcGG |  | MMP0001 MMP0098 MMP0159 MMP0245 MMP0248 MMP0434 MMP0441 MMP0452 MMP0476 MMP0477 MMP0671 MMP0763 MMP0782 MMP0816 MMP0903 MMP1331 MMP1378 MMP1390 MMP1572 MMP1586 MMP1685 MMP1687 RNA_37 RNA_38 RNA_4 RNA_44 RNA_48 RNA_6 | rpl39e pfdB rpoE2 ywbE korD rrnD5S rrnA23S tRNA-Ala2 rrnC16S rnnC5S | hypothetical protein | ferredoxin | 50S ribosomal protein L39e | prefoldin, beta subunit | DNA-directed RNA polymerase related protein | DNA-directed RNA polymerase subunit E | seryl-tRNA synthetase related | 2-oxoglutarate ferredoxin oxidoreductase, delta (ferredoxin) subunit | 5S ribosomal RNA | 23S ribosomal RNA | tRNA-Ala | 16S ribosomal RNA |
| 135 | 32 | 58 | 0.160 | | 
Residual = 0.785 |  | 
GaGGGgCC | 
ttnAAtTtAAAaTAT |  | MMP0006 MMP0007 MMP0043 MMP0054 MMP0059 MMP0219 MMP0268 MMP0368 MMP0378 MMP0493 MMP0517 MMP0542 MMP0544 MMP0742 MMP0754 MMP0809 MMP1153 MMP1164 MMP1170 MMP1193 MMP1243 MMP1244 MMP1309 MMP1386 MMP1436 MMP1568 MMP1571 MMP1602 MMP1604 MMP1610 Mma-sR09 RNA_29 | ppaC truA cobN ehbN fwdH ftsZ1 tRNA-Gly1 | 3-dehydroquinate synthase | geranylgeranylglyceryl phosphate synthase-like protein | isopentenyl pyrophosphate isomerase | hypothetical protein | putative manganese-dependent inorganic pyrophosphatase | tRNA pseudouridine synthase A | amidohydrolase | cobaltochelatase subunit CobN | MoaA/nifB/pqqE family protein | phosphoribosylaminoimidazole carboxylase related protein | energy conserving hydrogenase B large subunit | heavy metal transport/detoxification protein | glycosyl transferase family protein | UBA/THIF-type NAD/FAD binding protein | tungsten containing formylmethanofuran dehydrogenase, subunit H | cell division protein FtsZ | tRNA-Gly |
| 136 | 30 | 58 | 0.225 | | 
Residual = 0.815 |  | 
CcGAGGGGGG | 
CnAAAGctCcA |  | MMP0043 MMP0057 MMP0065 MMP0196 MMP0201 MMP0216 MMP0219 MMP0324 MMP0347 MMP0386 MMP0482 MMP0499 MMP0500 MMP0508 MMP0517 MMP0673 MMP0679 MMP0690 MMP0745 MMP0860 MMP1177 MMP1260 MMP1271 MMP1326 MMP1330 MMP1389 MMP1524 MMP1684 RNA_26 RNA_7 | cofH amtB III moeA ppaC HMmA fmdE nifX vorA rpoN secF tRNA-Leu3 tRNA-Ala2 | isopentenyl pyrophosphate isomerase | FO synthase subunit 2 | ammonium transporter | ABC-type iron(III) transport system, periplasmic binding protein | molybdenum cofactor biosynthesis protein | cation transport ATPase | putative manganese-dependent inorganic pyrophosphatase | hypothetical protein | histone A | Iron-sulfur flavoprotein-related | molybdenum containing formylmethanofuran dehydrogenase, subunit E | TPR repeat-containing protein | Na+/H+ antiporter related protein | polyferredoxin | nitrogen fixation-related protein | putative iron transport system substrate-binding protein, C-term half | 2-oxoisovalerate oxidoreductase subunit alpha | DNA-directed RNA polymerase subunit N | hydrogenase assembly chaperone hypC/hupF | preprotein translocase subunit SecF | metallophosphoesterase | tRNA-Leu | tRNA-Ala |
| 137 | 29 | 57 | 0.301 | | 
Residual = 0.882 |  | 
gAGcctCcTgAcCaC | 
CCTGCAaCAGtcaC |  | MMP0006 MMP0081 MMP0096 MMP0217 MMP0324 MMP0365 MMP0366 MMP0429 MMP0552 MMP0735 MMP0758 MMP0765 MMP0784 MMP0796 MMP0828 MMP0928 MMP0948 MMP1009 MMP1179 MMP1219 MMP1295 MMP1306 MMP1309 MMP1526 MMP1571 MMP1599 MMP1610 RNA_22 RNA_31 | gltB cheD pyrC rncS trkA tRNA-Met2 tRNA-Ala1 | 3-dehydroquinate synthase | glutamate synthase; large subunit; subunit 2 | putative transcriptional regulator, GntR family | transcriptional repressor related protein | hypothetical protein | N-6 adenine-specific DNA methylase:N6 adenine-specific DNA methyltransferase, D12 class | HNH endonuclease:HNH nuclease | sugar efflux transporter | chemoreceptor glutamine deamidase CheD | dihydroorotase | methyltransferase | putative dinG ATP-dependent helicase | glucose-6-phosphate isomerase | ribonuclease III family protein | TrkA-N domain protein | tRNA-Met | tRNA-Ala |
| 138 | 27 | 56 | 0.981 | | 
Residual = 0.812 |  | 
GGGGGACCTGC | 
GcGCgTG |  | MMP0193 MMP0414 MMP0439 MMP0450 MMP0453 MMP0460 MMP0465 MMP0505 MMP0523 MMP0534 MMP0566 MMP0715 MMP0739 MMP0758 MMP0789 MMP0895 MMP0930 MMP1012 MMP1069 MMP1216 MMP1333 MMP1466 MMP1641 RNA_10 RNA_12 RNA_13 RNA_3 | thrS pyrD codB cheR exoA hisC aroC ehaS tRNA-Arg1 tRNA-Val1 tRNA-Ser1 tRNA-Ala2 | hypothetical protein | threonyl-tRNA synthetase | dihydroorotate dehydrogenase 1B | ferredoxin | neutral zinc metallopeptidase | ABC transporter ATP-binding protein | MscS mechanosensitive ion channel | AMP-binding domain protein | coenzyme F390 synthetase II | Asp/Glu racemase:aspartate racemase | HNH endonuclease:HNH nuclease | cytosine permease | TPR repeat-containing protein | chemotaxis protein CheR | exodeoxyribonuclease III Xth | basic helix-loop-helix dimerization domain-containing protein | histidinol-phosphate aminotransferase | chorismate synthase | putative signal transduction protein with CBS domains | soluble P-type ATPase | tRNA-Arg | tRNA-Val | tRNA-Ser | tRNA-Ala |
| 139 | 9 | 57 | -3.183 | | 
Residual = 0.195 |  | 
ACGGcA | 
GaGGTG |  | MMP0017 MMP1039 MMP1040 MMP1041 MMP1044 MMP1045 MMP1563 MMP1564 MMP1566 | atpI atpK atpE atpA atpB mtrB mtrA mtrG | hypothetical protein | V-type ATP synthase subunit I | V-type ATP synthase subunit K | A1A0 ATPase, subunit IE | V-type ATP synthase subunit A | V-type ATP synthase subunit B | tetrahydromethanopterin S-methyltransferase subunit B | tetrahydromethanopterin S-methyltransferase subunit A | tetrahydromethanopterin S-methyltransferase subunit G |
| 140 | 14 | 56 | -1.749 | | 
Residual = 0.501 |  | 
CAGGCG | 
TCCTCC |  | MMP0295 MMP0712 MMP0719 MMP0783 MMP1135 MMP1247 MMP1249 MMP1251 MMP1258 MMP1286 MMP1555 MMP1558 MMP1692 MMP1720 | thrB fwdD fwdC hemB mcrB mcrG vhuB | homoserine kinase | amino acid ABC transporter substrate-binding protein | transcriptional regluator | hypothetical protein | flavodoxin:Beta-lactamase-like | tungsten containing formylmethanofuran dehydrogenase, subunit D | tungsten containing formylmethanofuran dehydrogenase, subunit C | putative signal-transduction protein with CBS domains | delta-aminolevulinic acid dehydratase | DNA primase | methyl-coenzyme M reductase I, beta subunit | methyl-coenzyme M reductase I, gamma subunit | polyferredoxin, associated with F420-non-reducing hydrogenase |
| 141 | 11 | 58 | -3.053 | | 
Residual = 0.404 |  | 
GGAgGT | 
AAatcAGctgaAAcaaccaaA |  | MMP0228 MMP0641 MMP1032 MMP1113 MMP1314 MMP1325 MMP1366 MMP1368 MMP1408 MMP1414 MMP1416 | trm1 rpl7ae rpa rps9p nusA rps17p rps8p rpl32e | N(2),N(2)-dimethylguanosine tRNA methyltransferase | 50S ribosomal protein L7Ae | replication factor A | transketoloase, C terminal half | phosphoesterase domain-containing protein | 30S ribosomal protein S9P | transcription elongation factor NusA | 30S ribosomal protein S7P | 30S ribosomal protein S17P | 30S ribosomal protein S8P | 50S ribosomal protein L32e |
| 142 | 27 | 57 | -0.714 | | 
Residual = 0.595 |  | 
aaTaTATAtTTTtC | 
GGTGaTTT |  | MMP0026 MMP0035 MMP0067 MMP0089 MMP0115 MMP0123 MMP0207 MMP0220 MMP0334 MMP0339 MMP0458 MMP0590 MMP0624 MMP0633 MMP0695 MMP0721 MMP0722 MMP0817 MMP0833 MMP0871 MMP1387 MMP1492 MMP1493 MMP1495 MMP1557 MMP1659 MMP1660 | DP2 glnK2 purT modC psmB frcB pyrE mcrC pyrB | DNA polymerase II large subunit | hypothetical protein | nitrogen regulatory protein P-II | siroheme synthase | nitroreductase | phosphoribosylglycinamide formyltransferase 2 | molybdenum ABC transporter ATP-binding protein | Sodium/proline symporter-related | RNA methyltransferase, TrmH family, group 1 | NUDIX hydrolase | glycosyl transferase family protein | rubrerythrin | proteasome, subunit beta | ferredoxin | coenzyme F420-reducing hydrogenase subunit beta | orotate phosphoribosyltransferase | radical SAM family protein | methyl coenzyme M reductase I, protein C | aspartate carbamoyltransferase catalytic subunit |
| 143 | 28 | 56 | -0.378 | | 
Residual = 0.818 |  | 
ATatgttttAatttAaAAATa | 
gGCACCTaGc |  | MMP0022 MMP0160 MMP0183 MMP0203 MMP0254 MMP0301 MMP0317 MMP0361 MMP0428 MMP0529 MMP0553 MMP0632 MMP0714 MMP0717 MMP0867 MMP0886 MMP0892 MMP0934 MMP0991 MMP1059 MMP1147 MMP1188 MMP1253 MMP1316 MMP1360 MMP1406 MMP1700 MMP1709 | ftsA-2 ribB hypA argF iorB2 rpl37e korB rpoH rpl44e | hypothetical protein | coenzyme F390 synthetase | 3,4-dihydroxy-2-butanone 4-phosphate synthase | carbohydrate kinase, YjeF related protein | hydrogenase nickel insertion protein HypA | vanadium nitrogenase-associated related protein N | sulfate transporter family protein | ornithine carbamoyltransferase | ATP/GTP-binding motif-containing protein | indolepyruvate oxidoreductase subunit beta | binding-protein-dependent transport systems inner membrane component | cobalt ABC transporter inner membrane protein | GCN5-related N-acetyltransferase | 50S ribosomal protein L37e | 2-oxoglutarate ferredoxin oxidoreductase subunit beta | DNA-directed RNA polymerase subunit H | translation initiation factor Sui1 | SSS sodium solute transporter superfamily | 50S ribosomal protein L44e |
| 144 | 21 | 57 | -0.420 | | 
Residual = 0.550 |  | 
TTTTcacTTTgGGaGGca | 
GGCCATTAAtgCgC |  | MMP0020 MMP0038 MMP0058 MMP0088 MMP0089 MMP0221 MMP0226 MMP0287 MMP0334 MMP0431 MMP0463 MMP0480 MMP0514 MMP0521 MMP0624 MMP0681 MMP1385 MMP1609 MMP1716 MMP1717 MMP1718 | mer hemA putP modA fruB ftr hmdII | nickel responsive regulator | type II secretion system protein | methylenetetrahydromethanopterin reductase | glutamyl-tRNA reductase | siroheme synthase | sodium/proline symporter | ExsB family transcriptional regulator | CBS domain containing protein | RNA methyltransferase, TrmH family, group 1 | rhodopsin-like GPCR superfamily protein | hypothetical protein | molybdenum ABC transporter periplasmic molybdate-binding protein | xanthine/uracil permease family protein | coenzyme F420-reducing hydrogenase subunit beta | formylmethanofuran--tetrahydromethanopterin formyltransferase | H(2)-dependent methylenetetrahydromethanopterin dehydrogenase-related protein | methyltransferase type 12 |
| 145 | 16 | 56 | -2.035 | | 
Residual = 0.723 |  | 
GCcCctaTTCA | 
CTACGCG |  | MMP0015 MMP0310 MMP0382 MMP0640 MMP0937 MMP1113 MMP1265 MMP1284 MMP1407 MMP1408 MMP1421 MMP1434 MMP1496 MMP1536 MMP1544 MMP1588 | rps28e cofE Gln rps17p rpl15p nusG pheS rpl4lp serA | hypothetical protein | putative ATPase RIL | 30S ribosomal protein S28e | F420-0--gamma-glutamyl ligase | transketoloase, C terminal half | glutamyl-tRNA(Gln) amidotransferase subunit E | DEAD/DEAH box helicase domain protein | ribonuclease P protein component 1 | 30S ribosomal protein S17P | 50S ribosomal protein L15P | transcription antitermination protein NusG | phenylalanyl-tRNA synthetase subunit alpha | 50S ribosomal protein L4P | D-3-phosphoglycerate dehydrogenase |
| 146 | 24 | 55 | -0.594 | | 
Residual = 0.832 |  | 
GGTGgaAA | 
TTCAAntgCagcaTTtngcnGgTT |  | MMP0010 MMP0108 MMP0280 MMP0433 MMP0544 MMP0545 MMP0548 MMP0552 MMP0608 MMP0610 MMP0659 MMP0686 MMP0716 MMP0802 MMP0904 MMP1014 MMP1219 MMP1250 MMP1381 MMP1393 MMP1437 MMP1499 MMP1522 MMP1573 | III hisI hisB tgtA selD top6A bioD | hypothetical protein | ABC-type Iron(III)-binding periplasmic protein precursor | phosphoribosyl-AMP cyclohydrolase | putative flavodoxin | MoaA/nifB/pqqE family protein | molybdenum cofactor biosynthesis protein MoeA | imidazoleglycerol-phosphate dehydratase | 2-hydroxyglutaryl-CoA dehydratase subunit A-like protein | 7-cyano-7-deazaguanine tRNA-ribosyltransferase | peptidase U32 | fructose-bisphosphate aldolase | amino acid-binding ACT domain protein | Iron-containing alcohol dehydrogenase | selenophosphate synthetase | radical SAM domain protein | putative dinG ATP-dependent helicase | 6-pyruvoyl tetrahydropterin synthase | Beta-lactamase-like protein | DNA topoisomerase VI subunit A | dethiobiotin synthase |
| 147 | 16 | 57 | -1.523 | | 
Residual = 0.491 |  | 
gCCCAC | 
CAGgAaCG |  | MMP0253 MMP0263 MMP0357 MMP0359 MMP0541 MMP0594 MMP0866 MMP1114 MMP1117 MMP1202 MMP1210 MMP1211 MMP1212 MMP1213 MMP1344 MMP1722 | acd tyrS serB proX rpe hisF | CoA-binding domain protein | tyrosyl-tRNA synthetase | UDP-N-acetylglucosamine 2-epimerase | glycosyl transferase family protein | phosphoserine phosphatase SerB | hypothetical protein | substrate-binding region of ABC-type glycine betaine transport system | Pentose-5-phosphate 3-epimerase | acetyl-CoA acetyltransferase | imidazole glycerol phosphate synthase subunit HisF |
| 148 | 26 | 57 | -1.528 | | 
Residual = 0.899 |  | 
AaTTTTTAAAA | 
GcGGGATAATCA |  | MMP0021 MMP0144 MMP0168 MMP0177 MMP0189 MMP0213 MMP0260 MMP0314 MMP0363 MMP0385 MMP0403 MMP0412 MMP0417 MMP0615 MMP0727 MMP0952 MMP1075 MMP1077 MMP1082 MMP1273 MMP1281 MMP1426 MMP1433 MMP1478 MMP1597 MMP1712 | hpcE rpl1P pyrH hisA uvrB aIF-5A dut hisH vorC dcd cbiA | hypothetical protein | 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase. | ParR family transcriptional regulator | triphosphoribosyl-dephospho-CoA protein | 50S ribosomal protein L1P | coenzyme F390 synthetase | methanol dehydrogenase regulatory protein related protein | uridylate kinase | MiaB-like tRNA modifying protein | 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)me thylideneamino)imidazole-4-carboxamide isomerase | excinuclease ABC subunit B | translation initiation factor IF-5A | dUTP diphosphatase | phosphoglucomutase/phosphomannomutase:calcium- bin ding EF-hand | imidazole glycerol phosphate synthase subunit HisH | 2-oxoisovalerate oxidoreductase subunit gamma | GCN5-related N-acetyltransferase | bifunctional dCTP deaminase/dUTP diphosphatase | ribosomal protein L11 | cobyrinic acid a,c-diamide synthase:cobyrinic acid a,c-diamide synthase CbiA | phosphatidylglycerophosphatase A | LysR family transcriptional regulator |
| 149 | 29 | 55 | 0.058 | | 
Residual = 0.666 |  | 
gGGGGtG | 
GTCGGGC |  | MMP0080 MMP0116 MMP0139 MMP0149 MMP0199 MMP0205 MMP0221 MMP0252 MMP0355 MMP0358 MMP0377 MMP0390 MMP0405 MMP0407 MMP0435 MMP0487 MMP0511 MMP0660 MMP0666 MMP0857 MMP0975 MMP1084 MMP1120 MMP1259 MMP1266 MMP1267 MMP1495 MMP1537 MMP1657 | argC fdhB modA putP gch3 fmdB apt nifK Gln | glutamate synthase; large subunit; subunit 1 | N-acetyl-gamma-glutamyl-phosphate reductase | formate dehydrogenase beta subunit | putative RNA methylase | hypothetical protein | molybdenum ABC transporter, periplasmic molybdenum-binding protein | sodium/proline symporter | isoleucyl-tRNA synthetase related | GTP cyclohydrolase III | molybdenum containing formylmethanofuran dehydrogenase, subunit B | adenine phosphoribosyltransferase | Na/Pi-cotransporter II-related protein | nitrogenase | molybdenum ABC transporter solute-binding protein | ATPase-like ATP-binding protein | FAD-dependent pyridine nucleotide-disulphide oxidoreductase | glutamyl-tRNA(Gln) amidotransferase subunit D | radical SAM family protein | cytochrome c heme-binding site |
| 150 | 24 | 56 | -1.344 | | 
Residual = 0.600 |  | 
aTCAAttatTTTgtagTcGAAAaT | 
TatAcTTAGtAaTATTTATTcaGT |  | MMP0028 MMP0153 MMP0250 MMP0251 MMP0277 MMP0284 MMP0317 MMP0427 MMP0537 MMP0578 MMP0616 MMP0625 MMP0669 MMP0729 MMP0902 MMP1083 MMP1371 MMP1433 MMP1498 MMP1579 MMP1658 MMP1679 MMP1680 MMP1681 | aksA psmA infB rfc nth1 aroQ uvrA rps10p rps15p glmS | cobyrinic acid a,c-diamide synthase | trans-homoaconitate synthase | putative RNA-associated protein | proteasome subunit alpha | TraB family protein | translation initiation factor IF-2 | hypothetical protein | replication factor C small subunit | endonuclease III homologue | chorismate mutase | OB-fold nucleic acid binding domain-containing protein | 50S ribosomal protein L14e | 30S ribosomal protein S3Ae | excinuclease ABC subunit A | imidazole glycerol phosphate synthase subunit HisF | 30S ribosomal protein S10P | ribosomal protein L11 | 30S ribosomal protein S15P | 30S ribosomal protein S8e | glucosamine--fructose-6-phosphate aminotransferase |